ID: 1203501155 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Un_KI270741v1:23707-23729 |
| Sequence | ATGGATACACAGTTTAAAAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1203501155_1203501158 | 25 | Left | 1203501155 | Un_KI270741v1:23707-23729 | CCCTTTTTAAACTGTGTATCCAT | No data | ||
| Right | 1203501158 | Un_KI270741v1:23755-23777 | AACTCCTAACAGAATAATGCCGG | 0: 9 1: 13 2: 21 3: 37 4: 161 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1203501155 | Original CRISPR | ATGGATACACAGTTTAAAAA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||