ID: 1203504968

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270741v1:60866-60888
Sequence GTGGGGAAGGGGAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203504947_1203504968 30 Left 1203504947 Un_KI270741v1:60813-60835 CCCGCTCTGGACGGTTCGCCAAA No data
Right 1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG No data
1203504955_1203504968 2 Left 1203504955 Un_KI270741v1:60841-60863 CCCAGGAGGTTGCTGCAGGAGCT No data
Right 1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG No data
1203504951_1203504968 12 Left 1203504951 Un_KI270741v1:60831-60853 CCAAACCTGCCCCAGGAGGTTGC No data
Right 1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG No data
1203504956_1203504968 1 Left 1203504956 Un_KI270741v1:60842-60864 CCAGGAGGTTGCTGCAGGAGCTG No data
Right 1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG No data
1203504952_1203504968 7 Left 1203504952 Un_KI270741v1:60836-60858 CCTGCCCCAGGAGGTTGCTGCAG No data
Right 1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG No data
1203504948_1203504968 29 Left 1203504948 Un_KI270741v1:60814-60836 CCGCTCTGGACGGTTCGCCAAAC No data
Right 1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG No data
1203504954_1203504968 3 Left 1203504954 Un_KI270741v1:60840-60862 CCCCAGGAGGTTGCTGCAGGAGC No data
Right 1203504968 Un_KI270741v1:60866-60888 GTGGGGAAGGGGAGGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203504968 Original CRISPR GTGGGGAAGGGGAGGGATGA GGG Intergenic
No off target data available for this crispr