ID: 1203505736

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270741v1:67345-67367
Sequence AAGAACATTCAGAAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203505736_1203505740 11 Left 1203505736 Un_KI270741v1:67345-67367 CCTGCTGTCTTCTGAATGTTCTT No data
Right 1203505740 Un_KI270741v1:67379-67401 ATTCCAGAACATTACTACGAGGG No data
1203505736_1203505739 10 Left 1203505736 Un_KI270741v1:67345-67367 CCTGCTGTCTTCTGAATGTTCTT No data
Right 1203505739 Un_KI270741v1:67378-67400 GATTCCAGAACATTACTACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203505736 Original CRISPR AAGAACATTCAGAAGACAGC AGG (reversed) Intergenic
No off target data available for this crispr