ID: 1203506037

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270741v1:70077-70099
Sequence GTGTTCTGGAAACCTAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203506037_1203506042 1 Left 1203506037 Un_KI270741v1:70077-70099 CCACAGTTAGGTTTCCAGAACAC No data
Right 1203506042 Un_KI270741v1:70101-70123 CCAGCTATCGTCTGAATGATTGG No data
1203506037_1203506043 20 Left 1203506037 Un_KI270741v1:70077-70099 CCACAGTTAGGTTTCCAGAACAC No data
Right 1203506043 Un_KI270741v1:70120-70142 TTGGCCTTCATATAAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203506037 Original CRISPR GTGTTCTGGAAACCTAACTG TGG (reversed) Intergenic