ID: 1203511341

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270741v1:121356-121378
Sequence TGAATGTTTATCCCTCACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203511341_1203511343 13 Left 1203511341 Un_KI270741v1:121356-121378 CCTATGTGAGGGATAAACATTCA No data
Right 1203511343 Un_KI270741v1:121392-121414 GTGTTGTGGAACCCTATCTGAGG No data
1203511341_1203511342 -1 Left 1203511341 Un_KI270741v1:121356-121378 CCTATGTGAGGGATAAACATTCA No data
Right 1203511342 Un_KI270741v1:121378-121400 AGACGAAAGCAGCAGTGTTGTGG No data
1203511341_1203511344 14 Left 1203511341 Un_KI270741v1:121356-121378 CCTATGTGAGGGATAAACATTCA No data
Right 1203511344 Un_KI270741v1:121393-121415 TGTTGTGGAACCCTATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203511341 Original CRISPR TGAATGTTTATCCCTCACAT AGG (reversed) Intergenic