ID: 1203519086

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000213v1:29789-29811
Sequence CTGCCAATCAAGGGCATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203519081_1203519086 -2 Left 1203519081 Un_GL000213v1:29768-29790 CCAGAGAAAATCCCATCAACTCT No data
Right 1203519086 Un_GL000213v1:29789-29811 CTGCCAATCAAGGGCATCAATGG No data
1203519080_1203519086 12 Left 1203519080 Un_GL000213v1:29754-29776 CCTCAAGGTGAGAGCCAGAGAAA No data
Right 1203519086 Un_GL000213v1:29789-29811 CTGCCAATCAAGGGCATCAATGG No data
1203519079_1203519086 13 Left 1203519079 Un_GL000213v1:29753-29775 CCCTCAAGGTGAGAGCCAGAGAA No data
Right 1203519086 Un_GL000213v1:29789-29811 CTGCCAATCAAGGGCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203519086 Original CRISPR CTGCCAATCAAGGGCATCAA TGG Intergenic
No off target data available for this crispr