ID: 1203519275

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000213v1:31575-31597
Sequence GGTGGTGGTTGTTCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203519275_1203519283 13 Left 1203519275 Un_GL000213v1:31575-31597 CCCTTTGCTGAACAACCACCACC No data
Right 1203519283 Un_GL000213v1:31611-31633 CCCCACACCCTTGGTTCTGCAGG No data
1203519275_1203519281 4 Left 1203519275 Un_GL000213v1:31575-31597 CCCTTTGCTGAACAACCACCACC No data
Right 1203519281 Un_GL000213v1:31602-31624 TTCTAGGATCCCCACACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203519275 Original CRISPR GGTGGTGGTTGTTCAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr