ID: 1203519281

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000213v1:31602-31624
Sequence TTCTAGGATCCCCACACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203519275_1203519281 4 Left 1203519275 Un_GL000213v1:31575-31597 CCCTTTGCTGAACAACCACCACC No data
Right 1203519281 Un_GL000213v1:31602-31624 TTCTAGGATCCCCACACCCTTGG No data
1203519276_1203519281 3 Left 1203519276 Un_GL000213v1:31576-31598 CCTTTGCTGAACAACCACCACCA No data
Right 1203519281 Un_GL000213v1:31602-31624 TTCTAGGATCCCCACACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203519281 Original CRISPR TTCTAGGATCCCCACACCCT TGG Intergenic
No off target data available for this crispr