ID: 1203519283

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000213v1:31611-31633
Sequence CCCCACACCCTTGGTTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203519278_1203519283 -2 Left 1203519278 Un_GL000213v1:31590-31612 CCACCACCAACATTCTAGGATCC No data
Right 1203519283 Un_GL000213v1:31611-31633 CCCCACACCCTTGGTTCTGCAGG No data
1203519280_1203519283 -8 Left 1203519280 Un_GL000213v1:31596-31618 CCAACATTCTAGGATCCCCACAC No data
Right 1203519283 Un_GL000213v1:31611-31633 CCCCACACCCTTGGTTCTGCAGG No data
1203519276_1203519283 12 Left 1203519276 Un_GL000213v1:31576-31598 CCTTTGCTGAACAACCACCACCA No data
Right 1203519283 Un_GL000213v1:31611-31633 CCCCACACCCTTGGTTCTGCAGG No data
1203519275_1203519283 13 Left 1203519275 Un_GL000213v1:31575-31597 CCCTTTGCTGAACAACCACCACC No data
Right 1203519283 Un_GL000213v1:31611-31633 CCCCACACCCTTGGTTCTGCAGG No data
1203519279_1203519283 -5 Left 1203519279 Un_GL000213v1:31593-31615 CCACCAACATTCTAGGATCCCCA No data
Right 1203519283 Un_GL000213v1:31611-31633 CCCCACACCCTTGGTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203519283 Original CRISPR CCCCACACCCTTGGTTCTGC AGG Intergenic
No off target data available for this crispr