ID: 1203519777

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000213v1:34603-34625
Sequence CTGCGCTGCCTGGGAAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203519777_1203519782 0 Left 1203519777 Un_GL000213v1:34603-34625 CCCTTTCTTCCCAGGCAGCGCAG No data
Right 1203519782 Un_GL000213v1:34626-34648 CCCTGCTCCTGCTGACACCATGG No data
1203519777_1203519786 9 Left 1203519777 Un_GL000213v1:34603-34625 CCCTTTCTTCCCAGGCAGCGCAG No data
Right 1203519786 Un_GL000213v1:34635-34657 TGCTGACACCATGGTCCAGGTGG No data
1203519777_1203519784 6 Left 1203519777 Un_GL000213v1:34603-34625 CCCTTTCTTCCCAGGCAGCGCAG No data
Right 1203519784 Un_GL000213v1:34632-34654 TCCTGCTGACACCATGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203519777 Original CRISPR CTGCGCTGCCTGGGAAGAAA GGG (reversed) Intergenic
No off target data available for this crispr