ID: 1203527764

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000213v1:105635-105657
Sequence GGTGAGATGCTAGCAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 7, 1: 0, 2: 4, 3: 28, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203527755_1203527764 6 Left 1203527755 Un_GL000213v1:105606-105628 CCTTTTCCTCTGCACAGCATTAC 0: 7
1: 0
2: 6
3: 26
4: 265
Right 1203527764 Un_GL000213v1:105635-105657 GGTGAGATGCTAGCAGGGGTGGG 0: 7
1: 0
2: 4
3: 28
4: 276
1203527754_1203527764 7 Left 1203527754 Un_GL000213v1:105605-105627 CCCTTTTCCTCTGCACAGCATTA 0: 7
1: 5
2: 3
3: 29
4: 287
Right 1203527764 Un_GL000213v1:105635-105657 GGTGAGATGCTAGCAGGGGTGGG 0: 7
1: 0
2: 4
3: 28
4: 276
1203527756_1203527764 0 Left 1203527756 Un_GL000213v1:105612-105634 CCTCTGCACAGCATTACCTCAAG 0: 7
1: 0
2: 3
3: 11
4: 141
Right 1203527764 Un_GL000213v1:105635-105657 GGTGAGATGCTAGCAGGGGTGGG 0: 7
1: 0
2: 4
3: 28
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203527764 Original CRISPR GGTGAGATGCTAGCAGGGGT GGG Intergenic
902564071 1:17298475-17298497 GGAGAGATGTTGGCAGGGCTGGG - Intergenic
903189754 1:21650054-21650076 TGTGGGGTGTTAGCAGGGGTGGG + Intronic
903414886 1:23175813-23175835 GGTGATATGCCAGGAGGGATTGG + Intronic
903974070 1:27137890-27137912 GGAGAGCTGCTAGCAGGGAGGGG - Intronic
904386918 1:30148920-30148942 TGAGAGATGCAGGCAGGGGTGGG - Intergenic
904456980 1:30653765-30653787 GGTCAGATGGGGGCAGGGGTGGG - Intergenic
904580837 1:31543045-31543067 AGTTGGAAGCTAGCAGGGGTTGG - Intergenic
904811239 1:33164686-33164708 GGGGAGATGATACCAGGGCTGGG + Intronic
905183947 1:36182915-36182937 GGAGAGGTGCTAGATGGGGTTGG + Intergenic
905311223 1:37050423-37050445 GGTTAGATACAAGAAGGGGTTGG + Intergenic
905708731 1:40082650-40082672 AGTGTGAAGCTAGCAGAGGTTGG + Intronic
906720454 1:48000631-48000653 CGTGAGATGTTAGCAGAGGAAGG - Intergenic
907308464 1:53526412-53526434 AGTGAGAAGCTTGCCGGGGTTGG + Intronic
908333618 1:63097339-63097361 GGTGAGAAGTTAGCTGAGGTGGG + Intergenic
908339101 1:63158101-63158123 GGTGAGGTGCTAGTAGTTGTGGG + Intergenic
908384104 1:63624240-63624262 GCAGAAATGCTAGGAGGGGTTGG + Intronic
908572587 1:65424881-65424903 CGTGAGATGCTATCAGGAGGTGG - Intronic
912642073 1:111356369-111356391 AGTGTGAAGCTAGCAGAGGTTGG - Intergenic
913349387 1:117841454-117841476 GGTGAGATGGTGGCAGAGCTAGG - Intergenic
913665416 1:121043808-121043830 GGTGAGAGGCTAGCAGAGAGTGG - Intergenic
914016813 1:143827079-143827101 GGTGAGAGGCTAGCAGAGAGTGG - Intergenic
914160973 1:145133932-145133954 GGTGAGAGGCTAGCAGAGAGTGG + Intergenic
914655423 1:149735620-149735642 GGTGAGAGGCTAGCAGAGAGTGG - Intergenic
914730300 1:150364095-150364117 GTTGAGAAGGAAGCAGGGGTAGG + Intronic
915166127 1:153948698-153948720 GGGGATATGTTAGCAGGGCTAGG - Intronic
915679617 1:157567944-157567966 GGTGAGACCCTAGCAGGCCTTGG - Intergenic
916745264 1:167680281-167680303 GGGTAGATGCTGGCAGGGGAGGG + Intronic
918264753 1:182831443-182831465 GGTGAGGTGCAAGTAGGGTTGGG + Intergenic
919781223 1:201222521-201222543 GGGGAGATGCTAGCGGGGGAGGG - Intronic
919871643 1:201826451-201826473 GGAAGGAAGCTAGCAGGGGTTGG - Exonic
920787100 1:209051827-209051849 GGTGGAGTGCTGGCAGGGGTGGG - Intergenic
921365408 1:214369018-214369040 GGTGAGAGGTTACCAGGGGCTGG - Intronic
921393596 1:214643998-214644020 GGTGAGGTGATGGCAGGTGTAGG + Intronic
921707932 1:218345625-218345647 GGGGAGAAGCCAGCAGAGGTTGG + Intergenic
922548495 1:226476230-226476252 GATGAGGTTCTAGGAGGGGTGGG + Intergenic
923100157 1:230807738-230807760 GGAGAGAAGGTAGCAGAGGTGGG + Intergenic
923936368 1:238764774-238764796 AGTTTGAAGCTAGCAGGGGTTGG - Intergenic
1062971997 10:1655090-1655112 GGTGAGGTTCCAGCAGGGGCAGG + Intronic
1064038350 10:11935160-11935182 GGTGAGATGCCAGGAGAGGGAGG - Intronic
1065413747 10:25461513-25461535 AGTTAGAAGCTAGCAGTGGTTGG + Intronic
1067950163 10:50727932-50727954 GATGAGAGGCTAGCAGGGAGCGG - Intergenic
1068081437 10:52322676-52322698 AGTTGGATGCTAGCAGAGGTTGG + Intergenic
1069900746 10:71705386-71705408 GATCAGAGGCTAGGAGGGGTGGG - Intronic
1070273570 10:74982384-74982406 GGTGAGACCCTAGCAGATGTTGG + Intronic
1071930019 10:90458546-90458568 GGTGAGAAGCATGGAGGGGTTGG + Intergenic
1072572518 10:96671257-96671279 GGTGAGAGGCTTGCAATGGTGGG + Intronic
1073763315 10:106654653-106654675 AGTGAGATGCTTGGAGGGTTTGG - Intronic
1075193181 10:120330107-120330129 GAGGAGAGGCTAGCAGGGCTGGG + Intergenic
1075815026 10:125258397-125258419 GGTGAGAGGCTGGCAGAGGTGGG - Intergenic
1076642420 10:131927662-131927684 TGTGCGATGCCAGCTGGGGTAGG - Intronic
1077322591 11:1948964-1948986 GATGAGAGGCTGGCAGGGGTTGG - Intronic
1077557354 11:3232039-3232061 GGCCAGATGGTGGCAGGGGTGGG - Intronic
1078099513 11:8321450-8321472 GGTGGGACCCTAGCAGGAGTGGG + Intergenic
1078722559 11:13897944-13897966 GGAGAGATGCTAAAAGGGGCAGG + Intergenic
1080416346 11:32073117-32073139 GGTGCGATGTTAACAGGGGTAGG - Intronic
1083214607 11:61210579-61210601 GGTGAAATTCTAGCATGGCTGGG - Intronic
1083217491 11:61229408-61229430 GGTGAAATTCTAGCATGGCTGGG - Intronic
1083220481 11:61249158-61249180 GGTGAAATTCTAGCATGGCTGGG - Intronic
1084553771 11:69864155-69864177 GGTGGGATGAAAGGAGGGGTGGG - Intergenic
1086471568 11:87118828-87118850 AGTGTGAAGCTAGCAGAGGTGGG - Intronic
1086958050 11:92954158-92954180 GGAGAGATTTTAGCAGTGGTCGG - Intergenic
1087421973 11:97940596-97940618 CGTTTGATGCTAGCAGAGGTTGG + Intergenic
1090257091 11:125292433-125292455 GGTGTGATGCTGGGTGGGGTGGG + Intronic
1091372595 11:135073305-135073327 GGTGAGAAGCGAGAAGGGCTCGG + Intergenic
1202805608 11_KI270721v1_random:4277-4299 GATGAGAGGCTGGCAGGGGTTGG - Intergenic
1092161234 12:6316526-6316548 GGTGAGGTGATATTAGGGGTAGG - Intronic
1092545582 12:9448692-9448714 GGTGAGCTCCTGGCAGGGCTGGG - Intergenic
1093002523 12:14013771-14013793 AGTGTGAAGCTAGCAGAGGTTGG - Intergenic
1093785570 12:23188266-23188288 AGTCAGATGGTAGCAGGGGATGG - Intergenic
1094507371 12:31073359-31073381 GGTGAGCTCCTGGCAGGGCTGGG + Intergenic
1097377662 12:58858816-58858838 GGTGTGAGGCTATCTGGGGTTGG - Intergenic
1098190120 12:67939013-67939035 AATGAGATGCTAGCAGAAGTTGG - Intergenic
1099131919 12:78843427-78843449 AGTCTGAAGCTAGCAGGGGTTGG + Intergenic
1100618777 12:96251787-96251809 AGTGTGAAGCTAGCAGAGGTTGG + Intronic
1101556769 12:105817238-105817260 GGTGAGATGGTAGCAGGTTTGGG - Intergenic
1101562195 12:105867595-105867617 GGTTGGAAGCTAGCAGAGGTTGG + Intergenic
1102534492 12:113570420-113570442 TGTGAGATTCTAGCAGGTGCTGG - Intergenic
1103725299 12:122994779-122994801 GGTGAGAGCCCAGCAGGGGCAGG - Exonic
1104010084 12:124924095-124924117 GGTGAGAAGCTAGGAGAGGGCGG + Intergenic
1104400519 12:128472344-128472366 TGTGAGATGCTAGCAGTTCTGGG + Intronic
1104729825 12:131098580-131098602 GGTGAGAAGCCAGCAGGACTCGG + Intronic
1104987419 12:132604684-132604706 GGTGAGGTGCGTGCAGGGGCGGG - Exonic
1105675530 13:22667877-22667899 CGTGAGATGGAAGCAGGGGTAGG - Intergenic
1108676263 13:52739838-52739860 GGTGAGGCGCTGGAAGGGGTGGG - Intergenic
1113263747 13:108593812-108593834 CGTGACATGCTAACAGGGCTTGG - Intergenic
1113388597 13:109873967-109873989 GCTGTGAGGCTAGCAAGGGTTGG - Intergenic
1113486988 13:110661336-110661358 AGTTGGAAGCTAGCAGGGGTTGG - Intronic
1113824577 13:113241449-113241471 GGTGTGTGGCTAGCAGGTGTGGG - Intronic
1114031301 14:18583306-18583328 GGTGATACGGGAGCAGGGGTCGG + Intergenic
1116013929 14:39383876-39383898 AGTTTGATGCTAGCAGAGGTTGG + Intronic
1119490974 14:75032907-75032929 GGAGAGAAACTAGGAGGGGTGGG + Intronic
1119650262 14:76378005-76378027 GGTTAGATTCTAGCTGGGGTGGG + Intronic
1121897415 14:97661422-97661444 GGTGGGAGGCCAGCAGGGGATGG - Intergenic
1202836420 14_GL000009v2_random:80482-80504 GGTTAGGTGCTGGCAGGGGTGGG - Intergenic
1123496662 15:20833689-20833711 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1123553897 15:21407281-21407303 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1123590141 15:21844646-21844668 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1124560420 15:30768869-30768891 AGTTAGAAGCTAGCAGAGGTTGG - Intronic
1126227595 15:46289590-46289612 GGTGGGATGCTGGCAGGTGTAGG + Intergenic
1126506147 15:49406564-49406586 GGTGGGGTGCTGGCCGGGGTGGG + Intronic
1126883671 15:53126272-53126294 GATGAAGTGCTGGCAGGGGTTGG + Intergenic
1127213765 15:56802610-56802632 GGTGAGGTGTTTGCAGGGGAAGG - Intronic
1128711129 15:69872736-69872758 GGTGAGATGGCAGCACGGGAGGG - Intergenic
1128815588 15:70605815-70605837 GGTGTGATGCTGGCAGGGAGAGG + Intergenic
1129049210 15:72764489-72764511 AGTCAGAAGCTAGCAGAGGTTGG + Intronic
1130408109 15:83621007-83621029 AGTCTGAGGCTAGCAGGGGTGGG - Intergenic
1130992025 15:88881335-88881357 GGTGAGATGCTAACGGGGACTGG - Exonic
1202962243 15_KI270727v1_random:134477-134499 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1133232969 16:4374976-4374998 GGTGTGATGCCACCAGGGCTGGG - Intronic
1133474033 16:6102570-6102592 CGTGAGCTGCTGGAAGGGGTGGG - Intronic
1133512897 16:6477931-6477953 AGTGTGAAGCTAGCAGAGGTTGG - Intronic
1135665123 16:24329084-24329106 GCTCAGATTCGAGCAGGGGTGGG + Intronic
1137400515 16:48150180-48150202 GAAGAGAGGCTAGCAGGGGCAGG - Intronic
1138825116 16:60309474-60309496 GGTGAGATGCAAGGAAGAGTTGG + Intergenic
1138838137 16:60463154-60463176 GGTAAGGTCCCAGCAGGGGTGGG + Intergenic
1141167788 16:81671921-81671943 GGTGAGAAGCCTGCAGGAGTGGG - Intronic
1141180370 16:81748880-81748902 GGTGAGATGCTGGCAGAGCTGGG + Intronic
1142363792 16:89639339-89639361 GGTGAGGTGTGTGCAGGGGTGGG - Intergenic
1142682952 17:1561370-1561392 GGAGAGATGGTGGAAGGGGTGGG - Intronic
1143340033 17:6203633-6203655 GGAGAGATGCTGGGAGGGGCTGG - Intergenic
1143675563 17:8430027-8430049 CGTGAGATGCAAGCTGGGGAGGG + Intronic
1144343989 17:14333651-14333673 GGTGAGAGGTTATCAGTGGTTGG + Intronic
1144728098 17:17511792-17511814 GGGGAGATGGGGGCAGGGGTGGG - Intronic
1144826892 17:18110187-18110209 GGTGAGAGGCTAGATGGGGCTGG - Intronic
1145909040 17:28532168-28532190 GATGAGATGCGGGGAGGGGTGGG - Intronic
1147947239 17:44086961-44086983 GGTAAGAGGCTGGGAGGGGTGGG + Intronic
1148217178 17:45839675-45839697 GGTGAGCTGAGGGCAGGGGTGGG - Intergenic
1150196794 17:63307085-63307107 TGTGAGATGCCTGCAGGGGTAGG + Intronic
1150597238 17:66616873-66616895 AATGGGAAGCTAGCAGGGGTGGG + Intronic
1151119852 17:71780613-71780635 AGTGTGAAGCTAGCAGAGGTTGG + Intergenic
1154454572 18:14509373-14509395 GGTGAGATGCTAGCAGGGGTGGG + Intronic
1156572218 18:38269249-38269271 AGTCTGATGCTAGCAGAGGTTGG - Intergenic
1157216856 18:45791429-45791451 GGTGAGAAGCAAGATGGGGTTGG - Intergenic
1160572443 18:79827389-79827411 GGTGAGATGCTATCTTAGGTAGG + Intergenic
1162453705 19:10769733-10769755 GGTCAGCTGATAGCAGGGCTGGG + Intronic
1164990229 19:32677313-32677335 GGGGCGACGCTGGCAGGGGTGGG - Exonic
1166074863 19:40408136-40408158 GGTGAGAGGACAGCTGGGGTGGG - Exonic
1166580140 19:43889764-43889786 GGTTGGATGCTAGCAGAGGTTGG - Intronic
1167240188 19:48338888-48338910 GGTGAGGGGTGAGCAGGGGTTGG + Intronic
1167677244 19:50894949-50894971 GGTGGCAGGCTAGCAGGGATGGG - Intergenic
1202636219 1_KI270706v1_random:46883-46905 GGTTAGGTGCTGGCAGGGGTGGG + Intergenic
925658284 2:6173936-6173958 TGTTTGATGCTAGCAGAGGTTGG + Intergenic
927004800 2:18836857-18836879 GGTGAGGTGGTGGCAGGGGGTGG - Intergenic
928351810 2:30564005-30564027 GTTGAGATTCTAGAAGTGGTTGG + Intronic
928852110 2:35760717-35760739 AGTTAGAAGCTAGCAGAGGTTGG + Intergenic
929795268 2:45054243-45054265 CATGAGATGATTGCAGGGGTGGG - Intergenic
932401320 2:71482804-71482826 CGTTAGATGCCAGCAGGAGTGGG + Intronic
933813628 2:86048743-86048765 GGTGAGATGCGAGGTGGGATGGG - Intronic
938496901 2:131802488-131802510 GGTGATATGGGAGCAGGGGTCGG - Intergenic
940464695 2:154013537-154013559 GGTGAGGTGCTGACAGGGGCGGG + Intronic
941889393 2:170562906-170562928 TGTGAGATGCTTGCTGGTGTGGG + Intronic
942492059 2:176499279-176499301 GCAGAGAGGCCAGCAGGGGTGGG - Intergenic
943251670 2:185529324-185529346 TGTGTGAGGCTAGCAGGAGTTGG - Intergenic
945441481 2:209885206-209885228 GGTGTGATGGTTGCAGGGGTGGG + Intronic
945973745 2:216254604-216254626 GGTGAGAGGGCAGCGGGGGTGGG - Intergenic
948339642 2:237239213-237239235 GGTGTGATGGTCCCAGGGGTTGG + Intergenic
1170663560 20:18365318-18365340 GGTGAGGTGCCAGAAGGGCTAGG + Intergenic
1171300287 20:24053683-24053705 GGTGAAATGCTAGAATGAGTTGG + Intergenic
1171456234 20:25274179-25274201 GGTGAGAGGCTGTCAGGGGCTGG - Intronic
1171882354 20:30627822-30627844 GGTGAGGTGCTGGCAGGGGTGGG + Intergenic
1172281872 20:33713553-33713575 GCTGACATTCTAGCAGGGGGTGG - Intronic
1172477230 20:35248112-35248134 TGGAAGATGCTAGCAGGGCTGGG + Intronic
1173581085 20:44147042-44147064 GGTGAGACACTAGATGGGGTTGG + Intronic
1174179843 20:48667952-48667974 GCTGAGAAGCTAGCAGGTGGAGG - Intronic
1174494791 20:50931556-50931578 AGTTAGGTGCAAGCAGGGGTGGG - Intergenic
1175112276 20:56657082-56657104 GGACAGATGCTGGCAGGGGTGGG - Intergenic
1176819596 21:13643935-13643957 GGTGAGATGCTAGCAGGGGTGGG - Intergenic
1177404549 21:20647879-20647901 GGTTGGAAGCTAGCAGAGGTTGG + Intergenic
1179307231 21:40165895-40165917 TGTGTGATGCTCGCAGGGGGTGG + Intronic
1180455414 22:15510364-15510386 GGTGATACGGGAGCAGGGGTCGG + Intergenic
1180902712 22:19386261-19386283 GATGACATACTAGGAGGGGTGGG - Intronic
1181500819 22:23314656-23314678 GGTGATAGGCTGGCTGGGGTTGG - Exonic
1181706046 22:24649964-24649986 GGTGACAGGCTGGCTGGGGTTGG - Intergenic
1181927739 22:26373931-26373953 GGAGAGATGGGAGAAGGGGTGGG - Intronic
1182614495 22:31577791-31577813 GGAGAGAGGCTAGCACTGGTGGG + Intronic
1183035193 22:35135742-35135764 GGTGAGATGCAAACAGGGTCGGG + Intergenic
1183417495 22:37690949-37690971 GGTCAGACACTATCAGGGGTGGG - Intronic
1183724453 22:39580715-39580737 GGTGGGTGTCTAGCAGGGGTGGG + Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1184601307 22:45545072-45545094 GATGAGATGGTCGCAGGGGTTGG + Intronic
950121373 3:10484367-10484389 GGTGAGATTCTAGAAGGGACAGG + Intronic
950814933 3:15691039-15691061 GGTGATATTCAAGCAGGGCTCGG - Intronic
951465959 3:23000750-23000772 GGTCTGATCCCAGCAGGGGTTGG - Intergenic
951856314 3:27200955-27200977 GGTGACAGGCCAGCAGGGATTGG + Intronic
953277658 3:41519043-41519065 GGAGCGATTCCAGCAGGGGTGGG - Intronic
954005952 3:47590717-47590739 GGTGGCATGCCAGGAGGGGTAGG + Exonic
954145297 3:48631466-48631488 GGGGAGATGCTGTCAGGGGCAGG + Intronic
954413523 3:50381629-50381651 GGCCAGAAGCAAGCAGGGGTGGG + Intronic
955497970 3:59556201-59556223 GGTGTGATTCCAGAAGGGGTGGG - Intergenic
956882604 3:73526427-73526449 GGTGAGGTGCTGGCAAGGCTGGG - Intronic
957334914 3:78815561-78815583 AGTGGGAAGCTAGCAGAGGTTGG + Intronic
959242033 3:103808645-103808667 GGTGAGGTGCTTGCAGGGGTGGG - Intergenic
960049925 3:113229404-113229426 AGGTAGATGCTAGCAGAGGTGGG - Intronic
961404434 3:126668279-126668301 TGTGAGATGCAAGCAGGGCGGGG + Intergenic
961540422 3:127595630-127595652 GAGGAGATCCTAGCAGGGCTGGG - Intronic
961829425 3:129615875-129615897 GGTGAGAGGCGAGCAGAGGAGGG + Intergenic
962001679 3:131304972-131304994 GGTGGGGTGCAAGCAGGGGTGGG + Intronic
963390710 3:144660254-144660276 GAGGAGATGGTAGCAGGGATAGG - Intergenic
966750826 3:183320514-183320536 AGTTTGAAGCTAGCAGGGGTTGG - Intronic
967941046 3:194767088-194767110 GCTGAGATGCAACGAGGGGTCGG + Intergenic
968244497 3:197129335-197129357 AATGTGAGGCTAGCAGGGGTTGG - Intronic
968873844 4:3254985-3255007 GGAGAGATGAAGGCAGGGGTGGG - Intronic
971086124 4:23277223-23277245 GATCTGATGCTAGCAGAGGTAGG + Intergenic
973366024 4:49210269-49210291 GGTGAGGTGCTGGCAGGGATGGG + Intergenic
973394573 4:49582182-49582204 GGTGAGGTGCTGGCAGGGGTGGG - Intergenic
974581902 4:63814459-63814481 GGTGGGGTGCTGGCAGGGGCAGG + Intergenic
975240756 4:72055929-72055951 AGTGTGAAGCTAGCAGAGGTTGG + Intronic
976147338 4:82054979-82055001 GCTGAGATGCAAGCTGGGCTAGG - Intergenic
976248169 4:83024366-83024388 AGTGACATGCTAGCAGTGGAAGG - Intergenic
978307843 4:107351728-107351750 GGTGAGAAGCAAGGTGGGGTTGG - Intergenic
980685273 4:136219694-136219716 GGTGGGGTACTAGCAAGGGTGGG + Intergenic
981670234 4:147278356-147278378 TGTGAGGTGCAAACAGGGGTTGG - Intergenic
982085079 4:151826832-151826854 AGTGGGAAGCTAGCAGAGGTTGG - Intergenic
984340376 4:178449728-178449750 GATGAGATGCTTCCAGGGTTGGG - Intergenic
985009743 4:185570170-185570192 GATGAGATGCATGCAGGGGCTGG + Intergenic
1202763533 4_GL000008v2_random:132750-132772 GGTTAGGTGCTGGCAGGGGTGGG + Intergenic
985885364 5:2673302-2673324 GGTAAGGTGGTAGCAGGGGTAGG + Intergenic
987763279 5:22192663-22192685 GGTGAGAGGTAAGGAGGGGTGGG + Intronic
988870626 5:35385248-35385270 GGTGGGGTGCTGGCAGGTGTAGG - Intergenic
990835894 5:60019617-60019639 AGTCAGATGCTAGGAGAGGTTGG - Intronic
991332848 5:65511187-65511209 AGTGTGAAGCTAGCAGAGGTTGG + Intergenic
991336163 5:65549678-65549700 AGTGTGAAGCTAGCAGAGGTTGG - Intronic
991897999 5:71425747-71425769 GGTGAGAGGTAAGGAGGGGTGGG + Intergenic
992066275 5:73113013-73113035 GGTGAGCTGGTAGGAGGTGTTGG + Intergenic
993811503 5:92484152-92484174 GATGAGAAGTTAGCATGGGTTGG + Intergenic
993898653 5:93570296-93570318 GGTGGGCTGCTGGTAGGGGTAGG - Intergenic
995732665 5:115262814-115262836 GATGAGAGGCTAGCAGGGAGCGG - Exonic
997611685 5:135220085-135220107 CCTGAGAGGCTGGCAGGGGTTGG + Intronic
999897643 5:156052352-156052374 GGGGAGAGGCTGGCAGGGTTTGG + Intronic
1001150230 5:169220917-169220939 GGTCAGATGCCAGAAGGGGCTGG - Intronic
1004437514 6:15610832-15610854 AGTTTGATGCTAGCAGAGGTTGG + Intronic
1004569274 6:16829661-16829683 AGTGTGAAGCTAGCAGAGGTTGG - Intergenic
1005431781 6:25764987-25765009 GGTGGGCTGGTGGCAGGGGTGGG - Intronic
1006191630 6:32213064-32213086 GGGGAGATGAGAGGAGGGGTGGG + Intronic
1006837958 6:37010602-37010624 GCTGGGATGCTGGCAGGGCTGGG + Intronic
1006861075 6:37171604-37171626 GGCTCGATGCTAGCCGGGGTGGG + Intronic
1010288871 6:74112499-74112521 GGTTTGAAGCTAGCAGAGGTTGG + Intergenic
1011544241 6:88466761-88466783 GGTGAGAGGGTAGCAAGGCTGGG + Intergenic
1011933739 6:92747820-92747842 GGCAAGCTGCTTGCAGGGGTGGG - Intergenic
1011976877 6:93312428-93312450 AGTTAGATGCTAGCAAGGGTAGG - Intronic
1012240889 6:96870321-96870343 GGTGAGCAGGTAGCAGTGGTAGG - Intergenic
1014817497 6:125952002-125952024 GCTGAGATGGTAGCAGGTTTTGG + Intergenic
1016825961 6:148388747-148388769 GCTTAGATGCAAGCAGGGCTTGG - Intronic
1017711718 6:157174919-157174941 GAGGAGATGCTAGCAGAGCTGGG - Intronic
1017740909 6:157405950-157405972 GGGGAGGTCCGAGCAGGGGTGGG - Intronic
1018840654 6:167514227-167514249 GCTGGGGTGCTAGCAGGGCTGGG + Intergenic
1021877420 7:25061800-25061822 GGTGAGATGATATGAGGTGTGGG - Intergenic
1022020996 7:26399021-26399043 GGTGAGCTGGTCGCAGGTGTGGG + Intergenic
1023717422 7:43058311-43058333 CATGAGGTGCTAGAAGGGGTTGG - Intergenic
1023763832 7:43492330-43492352 GGGTGGATGGTAGCAGGGGTCGG - Intronic
1029437212 7:100569996-100570018 GGGGAGAGGCCAGCAGGGGTGGG - Intergenic
1030598017 7:111562400-111562422 GCTGTGAGGCTGGCAGGGGTCGG - Intronic
1030809269 7:113955483-113955505 GGTGAAGTGCTGACAGGGGTGGG + Intronic
1033119349 7:138653140-138653162 AGTCTGAAGCTAGCAGGGGTTGG + Intronic
1033572634 7:142647409-142647431 GGTGAGAGGGTTGCAGGGGTGGG - Intergenic
1034461494 7:151200156-151200178 GGTGAGCTGCTGCCAGGGGCCGG + Intronic
1035074459 7:156169021-156169043 GGTGGGATGCTGGGGGGGGTGGG + Intergenic
1036605007 8:10296873-10296895 GGTGAGATGCCAGCAGGTAGTGG - Intronic
1037584609 8:20268173-20268195 GGTGAGATGGGAGTGGGGGTGGG - Intronic
1038526995 8:28283312-28283334 GGTTGGAAGCTAGCAGAGGTTGG + Intergenic
1040087996 8:43365553-43365575 GGTGAGGTGCTGGTGGGGGTGGG - Intergenic
1040555362 8:48473231-48473253 GGGGAGAGGCCAGCAGGTGTGGG + Intergenic
1041464188 8:58142551-58142573 GGGGTGATGGTGGCAGGGGTCGG - Intronic
1042112852 8:65399469-65399491 GAATAGAGGCTAGCAGGGGTTGG + Intergenic
1042976700 8:74478125-74478147 GGGGAGCAGCTAGTAGGGGTGGG + Intronic
1044449400 8:92316279-92316301 GTTGGGAAGCTAGCAGAGGTTGG + Intergenic
1046351731 8:113024056-113024078 GGTGAGTTGATAGGAGAGGTTGG - Intronic
1047303298 8:123633583-123633605 GGGGCAATCCTAGCAGGGGTGGG - Intergenic
1047368354 8:124233517-124233539 GGTGAGAAACTACCAGGGGATGG + Intergenic
1047788278 8:128176039-128176061 GGTGCGATGTTCGCAAGGGTCGG - Intergenic
1048130685 8:131693813-131693835 GGTGAACTGCTAAAAGGGGTGGG + Intergenic
1048294423 8:133203819-133203841 CGTGGGAGGCTAGCAGCGGTGGG - Intronic
1049890762 9:68640-68662 GGTGAGATGATCGCAAGGTTAGG - Intergenic
1051753658 9:20371152-20371174 AGTTTGATGCTAGCAGAGGTTGG + Intronic
1053732229 9:41069826-41069848 GGTGAGATGATCGCAAGGTTAGG - Intergenic
1054696223 9:68361891-68361913 GGTGAGATGATCGCAAGGTTAGG + Intronic
1055402362 9:75937836-75937858 AGTATGAAGCTAGCAGGGGTTGG - Intronic
1055760509 9:79602127-79602149 GGTTTGAAGCTAGCAGAGGTTGG + Intronic
1055766421 9:79668332-79668354 GGTGAGATGCCAGGAGGGCTTGG + Intronic
1056713046 9:89007182-89007204 GTAGAGATGCTAGAAGGGGCGGG - Intergenic
1057504538 9:95622029-95622051 AGTCAGAAGCTAGCAGAGGTTGG + Intergenic
1058428668 9:104898868-104898890 TGTTAGATACTAGCAGGTGTGGG - Intronic
1058473574 9:105306559-105306581 GGTGGGAAGCTGCCAGGGGTGGG - Intronic
1058643457 9:107108978-107109000 TCTGAGATGGCAGCAGGGGTTGG - Intergenic
1060565245 9:124585184-124585206 GGTTTGAAGCTAGCAGAGGTTGG + Intronic
1061187571 9:129063623-129063645 GCTGAGAAGGTAGCAGGGGGTGG + Exonic
1061328523 9:129878491-129878513 GATGGGATGCTGGCAGGGGAGGG + Intronic
1061571535 9:131480739-131480761 GTTGACATGCTAGCAGGGGGTGG - Intronic
1061704563 9:132442983-132443005 GGTTAGTGGTTAGCAGGGGTTGG - Intronic
1062489849 9:136799827-136799849 GGGGGGGTGCTGGCAGGGGTGGG - Intronic
1062651617 9:137580731-137580753 GGTGAGAGGGAAGCAGTGGTGGG + Intergenic
1203527764 Un_GL000213v1:105635-105657 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1203544288 Un_KI270743v1:117623-117645 GGTTAGGTGCTGGCAGGGGTGGG + Intergenic
1186042958 X:5501991-5502013 GGTGAGAGGCTGGGAGAGGTGGG + Intergenic
1186360163 X:8832715-8832737 GATGAGAGGCTATCAGGGGCTGG + Intergenic
1187800447 X:23056501-23056523 AGTGTGAAGCTAGCAGAGGTTGG + Intergenic
1187928044 X:24268361-24268383 GGAGGGATGGTGGCAGGGGTCGG - Intergenic
1188385425 X:29551784-29551806 TGAGAGATGCTGGGAGGGGTGGG - Intronic
1189708616 X:43785314-43785336 AGTGTGAAGCTAGCAGAGGTTGG - Intronic
1189923128 X:45923158-45923180 GTTCAGAAGCTAGCAGAGGTTGG + Intergenic
1190019761 X:46863504-46863526 GGAGATATTCTAGCAGGAGTTGG + Intronic
1190180649 X:48189051-48189073 CGTGTGAAGCTAGCAGAGGTTGG + Intronic
1190183568 X:48215566-48215588 CGTGTGAAGCTAGCAGAGGTTGG - Intronic
1190193696 X:48298554-48298576 CGTGTGAAGCTAGCAGAGGTTGG + Intergenic
1190305159 X:49077815-49077837 GGTGAGCTGTTGGCAGGGGAGGG - Exonic
1190655156 X:52605464-52605486 CGTGTGAAGCTAGCAGAGGTTGG + Intergenic
1190658231 X:52631468-52631490 CGTGTGAAGCTAGCAGAGGTTGG - Intergenic
1190660215 X:52647184-52647206 TGTGTGAAGCTAGCAGAGGTTGG + Intronic
1192028698 X:67485433-67485455 AGTGAGAAGGTAGCAGAGGTTGG - Intergenic
1192684507 X:73289304-73289326 GGTGAGGTGCTGGCAGGGGTGGG - Intergenic
1195699173 X:107689430-107689452 GGTGGGATGGTAGCCGGGGGAGG + Intergenic
1196721452 X:118858229-118858251 AGTGTGAAGCTAGCAGAGGTTGG + Intergenic
1199499840 X:148497554-148497576 GGTGAGGCACTGGCAGGGGTGGG + Intergenic
1200240579 X:154490962-154490984 GGTTAGACGTTAGCAGGGCTGGG + Intergenic
1201544377 Y:15144556-15144578 GGTGAGAGGCTGGGAGGTGTGGG + Intergenic