ID: 1203532403

View in Genome Browser
Species Human (GRCh38)
Location Un_GL000213v1:158691-158713
Sequence TTGAATAAGAATGGTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203532396_1203532403 12 Left 1203532396 Un_GL000213v1:158656-158678 CCCTGATTGCCCTGGCCAGAACT 0: 55
1: 62
2: 39
3: 75
4: 262
Right 1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG No data
1203532400_1203532403 -3 Left 1203532400 Un_GL000213v1:158671-158693 CCAGAACTTCCAATGCTGTGTTG 0: 18
1: 307
2: 2748
3: 11203
4: 3881
Right 1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG No data
1203532397_1203532403 11 Left 1203532397 Un_GL000213v1:158657-158679 CCTGATTGCCCTGGCCAGAACTT 0: 6624
1: 7821
2: 3183
3: 2190
4: 2951
Right 1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG No data
1203532398_1203532403 3 Left 1203532398 Un_GL000213v1:158665-158687 CCCTGGCCAGAACTTCCAATGCT 0: 67
1: 2203
2: 10932
3: 3695
4: 1407
Right 1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG No data
1203532399_1203532403 2 Left 1203532399 Un_GL000213v1:158666-158688 CCTGGCCAGAACTTCCAATGCTG 0: 14
1: 283
2: 2688
3: 10939
4: 3690
Right 1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203532403 Original CRISPR TTGAATAAGAATGGTGAGAA AGG Intergenic
No off target data available for this crispr