ID: 1203544841

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:121156-121178
Sequence AAGCGGGACCAGAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203544833_1203544841 -2 Left 1203544833 Un_KI270743v1:121135-121157 CCCCACTGGCTGACCCTGGAAAA No data
Right 1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG No data
1203544835_1203544841 -4 Left 1203544835 Un_KI270743v1:121137-121159 CCACTGGCTGACCCTGGAAAAGC No data
Right 1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG No data
1203544832_1203544841 1 Left 1203544832 Un_KI270743v1:121132-121154 CCTCCCCACTGGCTGACCCTGGA No data
Right 1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG No data
1203544834_1203544841 -3 Left 1203544834 Un_KI270743v1:121136-121158 CCCACTGGCTGACCCTGGAAAAG No data
Right 1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203544841 Original CRISPR AAGCGGGACCAGAGAGAAGA GGG Intergenic
No off target data available for this crispr