ID: 1203548671

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:151082-151104
Sequence AGGAATCACCTACAAACTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548671_1203548682 20 Left 1203548671 Un_KI270743v1:151082-151104 CCGTGAGTTTGTAGGTGATTCCT No data
Right 1203548682 Un_KI270743v1:151125-151147 AGGTGAAATCTGGAGATGGGTGG No data
1203548671_1203548678 10 Left 1203548671 Un_KI270743v1:151082-151104 CCGTGAGTTTGTAGGTGATTCCT No data
Right 1203548678 Un_KI270743v1:151115-151137 AGCTGACTCCAGGTGAAATCTGG No data
1203548671_1203548679 16 Left 1203548671 Un_KI270743v1:151082-151104 CCGTGAGTTTGTAGGTGATTCCT No data
Right 1203548679 Un_KI270743v1:151121-151143 CTCCAGGTGAAATCTGGAGATGG No data
1203548671_1203548680 17 Left 1203548671 Un_KI270743v1:151082-151104 CCGTGAGTTTGTAGGTGATTCCT No data
Right 1203548680 Un_KI270743v1:151122-151144 TCCAGGTGAAATCTGGAGATGGG No data
1203548671_1203548677 0 Left 1203548671 Un_KI270743v1:151082-151104 CCGTGAGTTTGTAGGTGATTCCT No data
Right 1203548677 Un_KI270743v1:151105-151127 GGGTGCGGGAAGCTGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548671 Original CRISPR AGGAATCACCTACAAACTCA CGG (reversed) Intergenic
No off target data available for this crispr