ID: 1203548676

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:151102-151124
Sequence GGAGTCAGCTTCCCGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548676_1203548678 -10 Left 1203548676 Un_KI270743v1:151102-151124 CCTGGGTGCGGGAAGCTGACTCC No data
Right 1203548678 Un_KI270743v1:151115-151137 AGCTGACTCCAGGTGAAATCTGG No data
1203548676_1203548680 -3 Left 1203548676 Un_KI270743v1:151102-151124 CCTGGGTGCGGGAAGCTGACTCC No data
Right 1203548680 Un_KI270743v1:151122-151144 TCCAGGTGAAATCTGGAGATGGG No data
1203548676_1203548679 -4 Left 1203548676 Un_KI270743v1:151102-151124 CCTGGGTGCGGGAAGCTGACTCC No data
Right 1203548679 Un_KI270743v1:151121-151143 CTCCAGGTGAAATCTGGAGATGG No data
1203548676_1203548682 0 Left 1203548676 Un_KI270743v1:151102-151124 CCTGGGTGCGGGAAGCTGACTCC No data
Right 1203548682 Un_KI270743v1:151125-151147 AGGTGAAATCTGGAGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548676 Original CRISPR GGAGTCAGCTTCCCGCACCC AGG (reversed) Intergenic
No off target data available for this crispr