ID: 1203548682

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:151125-151147
Sequence AGGTGAAATCTGGAGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548671_1203548682 20 Left 1203548671 Un_KI270743v1:151082-151104 CCGTGAGTTTGTAGGTGATTCCT No data
Right 1203548682 Un_KI270743v1:151125-151147 AGGTGAAATCTGGAGATGGGTGG No data
1203548676_1203548682 0 Left 1203548676 Un_KI270743v1:151102-151124 CCTGGGTGCGGGAAGCTGACTCC No data
Right 1203548682 Un_KI270743v1:151125-151147 AGGTGAAATCTGGAGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548682 Original CRISPR AGGTGAAATCTGGAGATGGG TGG Intergenic
No off target data available for this crispr