ID: 1203548804

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:151842-151864
Sequence CTTCAGCGGGAGTCCGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548804_1203548814 27 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548814 Un_KI270743v1:151892-151914 ACAGACAGGCCAGTCCCTGAGGG No data
1203548804_1203548812 13 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548812 Un_KI270743v1:151878-151900 GGAGAGTAGCTGGGACAGACAGG No data
1203548804_1203548809 -8 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548809 Un_KI270743v1:151857-151879 CGCTGAAGTGTGGGCGTGCTTGG No data
1203548804_1203548810 3 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548810 Un_KI270743v1:151868-151890 GGGCGTGCTTGGAGAGTAGCTGG No data
1203548804_1203548811 4 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548811 Un_KI270743v1:151869-151891 GGCGTGCTTGGAGAGTAGCTGGG No data
1203548804_1203548813 26 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548813 Un_KI270743v1:151891-151913 GACAGACAGGCCAGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548804 Original CRISPR CTTCAGCGGGAGTCCGTTGA AGG (reversed) Intergenic
No off target data available for this crispr