ID: 1203548809

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:151857-151879
Sequence CGCTGAAGTGTGGGCGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548804_1203548809 -8 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548809 Un_KI270743v1:151857-151879 CGCTGAAGTGTGGGCGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548809 Original CRISPR CGCTGAAGTGTGGGCGTGCT TGG Intergenic
No off target data available for this crispr