ID: 1203548810

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:151868-151890
Sequence GGGCGTGCTTGGAGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548804_1203548810 3 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548810 Un_KI270743v1:151868-151890 GGGCGTGCTTGGAGAGTAGCTGG No data
1203548807_1203548810 -10 Left 1203548807 Un_KI270743v1:151855-151877 CCCGCTGAAGTGTGGGCGTGCTT No data
Right 1203548810 Un_KI270743v1:151868-151890 GGGCGTGCTTGGAGAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548810 Original CRISPR GGGCGTGCTTGGAGAGTAGC TGG Intergenic
No off target data available for this crispr