ID: 1203548811

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:151869-151891
Sequence GGCGTGCTTGGAGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548807_1203548811 -9 Left 1203548807 Un_KI270743v1:151855-151877 CCCGCTGAAGTGTGGGCGTGCTT No data
Right 1203548811 Un_KI270743v1:151869-151891 GGCGTGCTTGGAGAGTAGCTGGG No data
1203548808_1203548811 -10 Left 1203548808 Un_KI270743v1:151856-151878 CCGCTGAAGTGTGGGCGTGCTTG No data
Right 1203548811 Un_KI270743v1:151869-151891 GGCGTGCTTGGAGAGTAGCTGGG No data
1203548804_1203548811 4 Left 1203548804 Un_KI270743v1:151842-151864 CCTTCAACGGACTCCCGCTGAAG No data
Right 1203548811 Un_KI270743v1:151869-151891 GGCGTGCTTGGAGAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548811 Original CRISPR GGCGTGCTTGGAGAGTAGCT GGG Intergenic
No off target data available for this crispr