ID: 1203548993

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:152910-152932
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203548976_1203548993 23 Left 1203548976 Un_KI270743v1:152864-152886 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG No data
1203548984_1203548993 5 Left 1203548984 Un_KI270743v1:152882-152904 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG No data
1203548975_1203548993 29 Left 1203548975 Un_KI270743v1:152858-152880 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG No data
1203548981_1203548993 7 Left 1203548981 Un_KI270743v1:152880-152902 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG No data
1203548983_1203548993 6 Left 1203548983 Un_KI270743v1:152881-152903 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG No data
1203548977_1203548993 22 Left 1203548977 Un_KI270743v1:152865-152887 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203548993 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr