ID: 1203549457

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:155639-155661
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203549457_1203549466 5 Left 1203549457 Un_KI270743v1:155639-155661 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203549466 Un_KI270743v1:155667-155689 CTCCCAGAAACTCAGACCCAAGG No data
1203549457_1203549467 6 Left 1203549457 Un_KI270743v1:155639-155661 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203549467 Un_KI270743v1:155668-155690 TCCCAGAAACTCAGACCCAAGGG No data
1203549457_1203549469 7 Left 1203549457 Un_KI270743v1:155639-155661 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203549469 Un_KI270743v1:155669-155691 CCCAGAAACTCAGACCCAAGGGG No data
1203549457_1203549473 22 Left 1203549457 Un_KI270743v1:155639-155661 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203549473 Un_KI270743v1:155684-155706 CCAAGGGGCAGCTCCTCACCAGG No data
1203549457_1203549475 29 Left 1203549457 Un_KI270743v1:155639-155661 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203549475 Un_KI270743v1:155691-155713 GCAGCTCCTCACCAGGGATGTGG No data
1203549457_1203549474 23 Left 1203549457 Un_KI270743v1:155639-155661 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203549474 Un_KI270743v1:155685-155707 CAAGGGGCAGCTCCTCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203549457 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr