ID: 1203549838

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:157763-157785
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203549838_1203549839 -5 Left 1203549838 Un_KI270743v1:157763-157785 CCATCTACTTGCTACTGTCACAC No data
Right 1203549839 Un_KI270743v1:157781-157803 CACACTCTTGCCAGCAGAAAAGG No data
1203549838_1203549841 7 Left 1203549838 Un_KI270743v1:157763-157785 CCATCTACTTGCTACTGTCACAC No data
Right 1203549841 Un_KI270743v1:157793-157815 AGCAGAAAAGGCCCCTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203549838 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr