ID: 1203550415

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:161951-161973
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203550415_1203550432 23 Left 1203550415 Un_KI270743v1:161951-161973 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203550432 Un_KI270743v1:161997-162019 CAAGGGGCAGCTCCTCACCAGGG No data
1203550415_1203550433 29 Left 1203550415 Un_KI270743v1:161951-161973 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203550433 Un_KI270743v1:162003-162025 GCAGCTCCTCACCAGGGATGTGG No data
1203550415_1203550424 5 Left 1203550415 Un_KI270743v1:161951-161973 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203550424 Un_KI270743v1:161979-162001 CTCCCAGAAACTCAGACCCAAGG No data
1203550415_1203550427 7 Left 1203550415 Un_KI270743v1:161951-161973 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203550427 Un_KI270743v1:161981-162003 CCCAGAAACTCAGACCCAAGGGG No data
1203550415_1203550425 6 Left 1203550415 Un_KI270743v1:161951-161973 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203550425 Un_KI270743v1:161980-162002 TCCCAGAAACTCAGACCCAAGGG No data
1203550415_1203550431 22 Left 1203550415 Un_KI270743v1:161951-161973 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1203550431 Un_KI270743v1:161996-162018 CCAAGGGGCAGCTCCTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203550415 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr