ID: 1203550777

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:163928-163950
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203550777_1203550778 -5 Left 1203550777 Un_KI270743v1:163928-163950 CCATCTACTTGCTACTGTCACAC No data
Right 1203550778 Un_KI270743v1:163946-163968 CACACTCTTGCCAGCAAAAGAGG No data
1203550777_1203550780 7 Left 1203550777 Un_KI270743v1:163928-163950 CCATCTACTTGCTACTGTCACAC No data
Right 1203550780 Un_KI270743v1:163958-163980 AGCAAAAGAGGCCCCTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203550777 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr