ID: 1203551385

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:166810-166832
Sequence CAGTCCCTGCACTGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203551385_1203551394 27 Left 1203551385 Un_KI270743v1:166810-166832 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1203551394 Un_KI270743v1:166860-166882 ACCCAGGCCGTGTTTCTCCGTGG No data
1203551385_1203551393 11 Left 1203551385 Un_KI270743v1:166810-166832 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1203551393 Un_KI270743v1:166844-166866 CTTTCGTCTGTGGGGCACCCAGG No data
1203551385_1203551392 3 Left 1203551385 Un_KI270743v1:166810-166832 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1203551392 Un_KI270743v1:166836-166858 GGAAGACACTTTCGTCTGTGGGG No data
1203551385_1203551391 2 Left 1203551385 Un_KI270743v1:166810-166832 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1203551391 Un_KI270743v1:166835-166857 GGGAAGACACTTTCGTCTGTGGG No data
1203551385_1203551390 1 Left 1203551385 Un_KI270743v1:166810-166832 CCTGGGTCCCAGTGCAGGGACTG No data
Right 1203551390 Un_KI270743v1:166834-166856 TGGGAAGACACTTTCGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203551385 Original CRISPR CAGTCCCTGCACTGGGACCC AGG (reversed) Intergenic
No off target data available for this crispr