ID: 1203552142

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:172057-172079
Sequence AGAGCTCCAGATCTCTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203552142_1203552156 23 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552156 Un_KI270743v1:172103-172125 GCAGGGTCTGGCAGGCTCTCAGG No data
1203552142_1203552148 0 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552148 Un_KI270743v1:172080-172102 GACAGAGGAGGAGCCGGGCCGGG No data
1203552142_1203552149 1 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552149 Un_KI270743v1:172081-172103 ACAGAGGAGGAGCCGGGCCGGGG No data
1203552142_1203552146 -5 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552146 Un_KI270743v1:172075-172097 GCTCTGACAGAGGAGGAGCCGGG No data
1203552142_1203552145 -6 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552145 Un_KI270743v1:172074-172096 AGCTCTGACAGAGGAGGAGCCGG No data
1203552142_1203552159 30 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552159 Un_KI270743v1:172110-172132 CTGGCAGGCTCTCAGGCCAGGGG No data
1203552142_1203552147 -1 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552147 Un_KI270743v1:172079-172101 TGACAGAGGAGGAGCCGGGCCGG No data
1203552142_1203552157 28 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552157 Un_KI270743v1:172108-172130 GTCTGGCAGGCTCTCAGGCCAGG No data
1203552142_1203552151 6 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552151 Un_KI270743v1:172086-172108 GGAGGAGCCGGGCCGGGGCAGGG No data
1203552142_1203552158 29 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552158 Un_KI270743v1:172109-172131 TCTGGCAGGCTCTCAGGCCAGGG No data
1203552142_1203552154 15 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552154 Un_KI270743v1:172095-172117 GGGCCGGGGCAGGGTCTGGCAGG No data
1203552142_1203552152 11 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552152 Un_KI270743v1:172091-172113 AGCCGGGCCGGGGCAGGGTCTGG No data
1203552142_1203552150 5 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552150 Un_KI270743v1:172085-172107 AGGAGGAGCCGGGCCGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203552142 Original CRISPR AGAGCTCCAGATCTCTATCC AGG (reversed) Intergenic
No off target data available for this crispr