ID: 1203552153

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:172093-172115
Sequence TGCCAGACCCTGCCCCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203552153_1203552161 11 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552161 Un_KI270743v1:172127-172149 CAGGGGCACCCGCGATCCAGAGG No data
1203552153_1203552162 14 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552162 Un_KI270743v1:172130-172152 GGGCACCCGCGATCCAGAGGCGG No data
1203552153_1203552158 -7 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552158 Un_KI270743v1:172109-172131 TCTGGCAGGCTCTCAGGCCAGGG No data
1203552153_1203552157 -8 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552157 Un_KI270743v1:172108-172130 GTCTGGCAGGCTCTCAGGCCAGG No data
1203552153_1203552166 21 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552166 Un_KI270743v1:172137-172159 CGCGATCCAGAGGCGGCCCAGGG No data
1203552153_1203552159 -6 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552159 Un_KI270743v1:172110-172132 CTGGCAGGCTCTCAGGCCAGGGG No data
1203552153_1203552165 20 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552165 Un_KI270743v1:172136-172158 CCGCGATCCAGAGGCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203552153 Original CRISPR TGCCAGACCCTGCCCCGGCC CGG (reversed) Intergenic
No off target data available for this crispr