ID: 1203552155

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:172098-172120
Sequence GAGCCTGCCAGACCCTGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203552155_1203552166 16 Left 1203552155 Un_KI270743v1:172098-172120 CCGGGGCAGGGTCTGGCAGGCTC No data
Right 1203552166 Un_KI270743v1:172137-172159 CGCGATCCAGAGGCGGCCCAGGG No data
1203552155_1203552161 6 Left 1203552155 Un_KI270743v1:172098-172120 CCGGGGCAGGGTCTGGCAGGCTC No data
Right 1203552161 Un_KI270743v1:172127-172149 CAGGGGCACCCGCGATCCAGAGG No data
1203552155_1203552162 9 Left 1203552155 Un_KI270743v1:172098-172120 CCGGGGCAGGGTCTGGCAGGCTC No data
Right 1203552162 Un_KI270743v1:172130-172152 GGGCACCCGCGATCCAGAGGCGG No data
1203552155_1203552165 15 Left 1203552155 Un_KI270743v1:172098-172120 CCGGGGCAGGGTCTGGCAGGCTC No data
Right 1203552165 Un_KI270743v1:172136-172158 CCGCGATCCAGAGGCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203552155 Original CRISPR GAGCCTGCCAGACCCTGCCC CGG (reversed) Intergenic
No off target data available for this crispr