ID: 1203552159

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:172110-172132
Sequence CTGGCAGGCTCTCAGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203552142_1203552159 30 Left 1203552142 Un_KI270743v1:172057-172079 CCTGGATAGAGATCTGGAGCTCT No data
Right 1203552159 Un_KI270743v1:172110-172132 CTGGCAGGCTCTCAGGCCAGGGG No data
1203552153_1203552159 -6 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552159 Un_KI270743v1:172110-172132 CTGGCAGGCTCTCAGGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203552159 Original CRISPR CTGGCAGGCTCTCAGGCCAG GGG Intergenic
No off target data available for this crispr