ID: 1203552161

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:172127-172149
Sequence CAGGGGCACCCGCGATCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203552153_1203552161 11 Left 1203552153 Un_KI270743v1:172093-172115 CCGGGCCGGGGCAGGGTCTGGCA No data
Right 1203552161 Un_KI270743v1:172127-172149 CAGGGGCACCCGCGATCCAGAGG No data
1203552155_1203552161 6 Left 1203552155 Un_KI270743v1:172098-172120 CCGGGGCAGGGTCTGGCAGGCTC No data
Right 1203552161 Un_KI270743v1:172127-172149 CAGGGGCACCCGCGATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203552161 Original CRISPR CAGGGGCACCCGCGATCCAG AGG Intergenic
No off target data available for this crispr