ID: 1203555728

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270743v1:206175-206197
Sequence GGTAATGTGTCTAGAGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203555728_1203555741 22 Left 1203555728 Un_KI270743v1:206175-206197 CCCAATGCTCTAGACACATTACC No data
Right 1203555741 Un_KI270743v1:206220-206242 GAAAAAGAAAAACTTCTCCAGGG No data
1203555728_1203555740 21 Left 1203555728 Un_KI270743v1:206175-206197 CCCAATGCTCTAGACACATTACC No data
Right 1203555740 Un_KI270743v1:206219-206241 TGAAAAAGAAAAACTTCTCCAGG No data
1203555728_1203555742 23 Left 1203555728 Un_KI270743v1:206175-206197 CCCAATGCTCTAGACACATTACC No data
Right 1203555742 Un_KI270743v1:206221-206243 AAAAAGAAAAACTTCTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203555728 Original CRISPR GGTAATGTGTCTAGAGCATT GGG (reversed) Intergenic
No off target data available for this crispr