ID: 1203563219

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270744v1:74505-74527
Sequence GCTGCCTGGCAGAGGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203563219_1203563231 18 Left 1203563219 Un_KI270744v1:74505-74527 CCATCCAGCCTCTGCCAGGCAGC No data
Right 1203563231 Un_KI270744v1:74546-74568 CAGGGCAGCCTCCGCAGCACAGG No data
1203563219_1203563228 0 Left 1203563219 Un_KI270744v1:74505-74527 CCATCCAGCCTCTGCCAGGCAGC No data
Right 1203563228 Un_KI270744v1:74528-74550 ATGGCCCTGGGTGGCTTTCAGGG No data
1203563219_1203563227 -1 Left 1203563219 Un_KI270744v1:74505-74527 CCATCCAGCCTCTGCCAGGCAGC No data
Right 1203563227 Un_KI270744v1:74527-74549 CATGGCCCTGGGTGGCTTTCAGG No data
1203563219_1203563226 -9 Left 1203563219 Un_KI270744v1:74505-74527 CCATCCAGCCTCTGCCAGGCAGC No data
Right 1203563226 Un_KI270744v1:74519-74541 CCAGGCAGCATGGCCCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203563219 Original CRISPR GCTGCCTGGCAGAGGCTGGA TGG (reversed) Intergenic
No off target data available for this crispr