ID: 1203563486

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270744v1:75656-75678
Sequence CAGTCAGAGCAGGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203563477_1203563486 23 Left 1203563477 Un_KI270744v1:75610-75632 CCAGAACTGCTATGCTCGCTACC No data
Right 1203563486 Un_KI270744v1:75656-75678 CAGTCAGAGCAGGAGCTGCAGGG No data
1203563479_1203563486 2 Left 1203563479 Un_KI270744v1:75631-75653 CCACCAGGCCTTCGCCAACTGCA No data
Right 1203563486 Un_KI270744v1:75656-75678 CAGTCAGAGCAGGAGCTGCAGGG No data
1203563481_1203563486 -6 Left 1203563481 Un_KI270744v1:75639-75661 CCTTCGCCAACTGCAACCAGTCA No data
Right 1203563486 Un_KI270744v1:75656-75678 CAGTCAGAGCAGGAGCTGCAGGG No data
1203563480_1203563486 -1 Left 1203563480 Un_KI270744v1:75634-75656 CCAGGCCTTCGCCAACTGCAACC No data
Right 1203563486 Un_KI270744v1:75656-75678 CAGTCAGAGCAGGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203563486 Original CRISPR CAGTCAGAGCAGGAGCTGCA GGG Intergenic
No off target data available for this crispr