ID: 1203568043

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270744v1:108393-108415
Sequence GTGTGACAGTAGCAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203568041_1203568043 -5 Left 1203568041 Un_KI270744v1:108375-108397 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG No data
1203568039_1203568043 7 Left 1203568039 Un_KI270744v1:108363-108385 CCATTACAGGGGCCTCTTCTGCT No data
Right 1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203568043 Original CRISPR GTGTGACAGTAGCAAGTGGA AGG Intergenic
No off target data available for this crispr