ID: 1203569112

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270744v1:115471-115493
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203569094_1203569112 29 Left 1203569094 Un_KI270744v1:115419-115441 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG No data
1203569102_1203569112 6 Left 1203569102 Un_KI270744v1:115442-115464 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG No data
1203569095_1203569112 23 Left 1203569095 Un_KI270744v1:115425-115447 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG No data
1203569103_1203569112 5 Left 1203569103 Un_KI270744v1:115443-115465 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG No data
1203569100_1203569112 7 Left 1203569100 Un_KI270744v1:115441-115463 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG No data
1203569096_1203569112 22 Left 1203569096 Un_KI270744v1:115426-115448 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203569112 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr