ID: 1203570061

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270744v1:121760-121782
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203570051_1203570061 6 Left 1203570051 Un_KI270744v1:121731-121753 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG No data
1203570044_1203570061 23 Left 1203570044 Un_KI270744v1:121714-121736 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG No data
1203570045_1203570061 22 Left 1203570045 Un_KI270744v1:121715-121737 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG No data
1203570052_1203570061 5 Left 1203570052 Un_KI270744v1:121732-121754 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG No data
1203570043_1203570061 29 Left 1203570043 Un_KI270744v1:121708-121730 CCACATCCCTGGTGAGGAGCTGC No data
Right 1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG No data
1203570049_1203570061 7 Left 1203570049 Un_KI270744v1:121730-121752 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203570061 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr