ID: 1203589014

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:39185-39207
Sequence CGGCAAAAAGCCGCGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589014_1203589024 28 Left 1203589014 Un_KI270747v1:39185-39207 CCTGCCACCGCGGCTTTTTGCCG No data
Right 1203589024 Un_KI270747v1:39236-39258 GCTTTTTGCCACCGCCGCCGCGG No data
1203589014_1203589018 -10 Left 1203589014 Un_KI270747v1:39185-39207 CCTGCCACCGCGGCTTTTTGCCG No data
Right 1203589018 Un_KI270747v1:39198-39220 CTTTTTGCCGCTACCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589014 Original CRISPR CGGCAAAAAGCCGCGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr