ID: 1203589189

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:39921-39943
Sequence CGGCAAAAAGCCGTAGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589189_1203589200 27 Left 1203589189 Un_KI270747v1:39921-39943 CCCGCCACTACGGCTTTTTGCCG No data
Right 1203589200 Un_KI270747v1:39971-39993 GCTTTTTGCCCTCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589189 Original CRISPR CGGCAAAAAGCCGTAGTGGC GGG (reversed) Intergenic
No off target data available for this crispr