ID: 1203589307

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:40487-40509
Sequence CCGCAAAAAGCAGCGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589307_1203589320 21 Left 1203589307 Un_KI270747v1:40487-40509 CCCGCCACCGCTGCTTTTTGCGG No data
Right 1203589320 Un_KI270747v1:40531-40553 GGCTTTTTGCCCCGCCACTACGG No data
1203589307_1203589312 0 Left 1203589307 Un_KI270747v1:40487-40509 CCCGCCACCGCTGCTTTTTGCGG No data
Right 1203589312 Un_KI270747v1:40510-40532 CTTTTTGCCCCCCACCGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589307 Original CRISPR CCGCAAAAAGCAGCGGTGGC GGG (reversed) Intergenic
No off target data available for this crispr