ID: 1203589322

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:40541-40563
Sequence CGGCAAAAAGCCGTAGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589322_1203589326 5 Left 1203589322 Un_KI270747v1:40541-40563 CCCGCCACTACGGCTTTTTGCCG No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589322_1203589332 27 Left 1203589322 Un_KI270747v1:40541-40563 CCCGCCACTACGGCTTTTTGCCG No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589322 Original CRISPR CGGCAAAAAGCCGTAGTGGC GGG (reversed) Intergenic
No off target data available for this crispr