ID: 1203589326

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:40569-40591
Sequence GCTTTTTGCCCCCGAAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589315_1203589326 27 Left 1203589315 Un_KI270747v1:40519-40541 CCCCACCGCCACGGCTTTTTGCC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589316_1203589326 26 Left 1203589316 Un_KI270747v1:40520-40542 CCCACCGCCACGGCTTTTTGCCC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589324_1203589326 1 Left 1203589324 Un_KI270747v1:40545-40567 CCACTACGGCTTTTTGCCGCTGC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589323_1203589326 4 Left 1203589323 Un_KI270747v1:40542-40564 CCGCCACTACGGCTTTTTGCCGC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589322_1203589326 5 Left 1203589322 Un_KI270747v1:40541-40563 CCCGCCACTACGGCTTTTTGCCG No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589321_1203589326 6 Left 1203589321 Un_KI270747v1:40540-40562 CCCCGCCACTACGGCTTTTTGCC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589319_1203589326 19 Left 1203589319 Un_KI270747v1:40527-40549 CCACGGCTTTTTGCCCCGCCACT No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589318_1203589326 22 Left 1203589318 Un_KI270747v1:40524-40546 CCGCCACGGCTTTTTGCCCCGCC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589314_1203589326 28 Left 1203589314 Un_KI270747v1:40518-40540 CCCCCACCGCCACGGCTTTTTGC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589313_1203589326 29 Left 1203589313 Un_KI270747v1:40517-40539 CCCCCCACCGCCACGGCTTTTTG No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data
1203589317_1203589326 25 Left 1203589317 Un_KI270747v1:40521-40543 CCACCGCCACGGCTTTTTGCCCC No data
Right 1203589326 Un_KI270747v1:40569-40591 GCTTTTTGCCCCCGAAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589326 Original CRISPR GCTTTTTGCCCCCGAAGCCA CGG Intergenic
No off target data available for this crispr