ID: 1203589327

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:40577-40599
Sequence GCAAAAAGCCGTGGCTTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589327_1203589332 -9 Left 1203589327 Un_KI270747v1:40577-40599 CCCCCGAAGCCACGGCTTTTTGC No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data
1203589327_1203589338 13 Left 1203589327 Un_KI270747v1:40577-40599 CCCCCGAAGCCACGGCTTTTTGC No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589327_1203589337 12 Left 1203589327 Un_KI270747v1:40577-40599 CCCCCGAAGCCACGGCTTTTTGC No data
Right 1203589337 Un_KI270747v1:40612-40634 GGCTTTTTGCACCCACAGCCGGG No data
1203589327_1203589336 11 Left 1203589327 Un_KI270747v1:40577-40599 CCCCCGAAGCCACGGCTTTTTGC No data
Right 1203589336 Un_KI270747v1:40611-40633 CGGCTTTTTGCACCCACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589327 Original CRISPR GCAAAAAGCCGTGGCTTCGG GGG (reversed) Intergenic