ID: 1203589332

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:40591-40613
Sequence GCTTTTTGCCCTCACCGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589328_1203589332 -10 Left 1203589328 Un_KI270747v1:40578-40600 CCCCGAAGCCACGGCTTTTTGCC No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data
1203589324_1203589332 23 Left 1203589324 Un_KI270747v1:40545-40567 CCACTACGGCTTTTTGCCGCTGC No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data
1203589323_1203589332 26 Left 1203589323 Un_KI270747v1:40542-40564 CCGCCACTACGGCTTTTTGCCGC No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data
1203589321_1203589332 28 Left 1203589321 Un_KI270747v1:40540-40562 CCCCGCCACTACGGCTTTTTGCC No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data
1203589322_1203589332 27 Left 1203589322 Un_KI270747v1:40541-40563 CCCGCCACTACGGCTTTTTGCCG No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data
1203589327_1203589332 -9 Left 1203589327 Un_KI270747v1:40577-40599 CCCCCGAAGCCACGGCTTTTTGC No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data
1203589325_1203589332 7 Left 1203589325 Un_KI270747v1:40561-40583 CCGCTGCAGCTTTTTGCCCCCGA No data
Right 1203589332 Un_KI270747v1:40591-40613 GCTTTTTGCCCTCACCGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589332 Original CRISPR GCTTTTTGCCCTCACCGCTG CGG Intergenic
No off target data available for this crispr