ID: 1203589338

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270747v1:40613-40635
Sequence GCTTTTTGCACCCACAGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203589333_1203589338 -9 Left 1203589333 Un_KI270747v1:40599-40621 CCCTCACCGCTGCGGCTTTTTGC No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589330_1203589338 10 Left 1203589330 Un_KI270747v1:40580-40602 CCGAAGCCACGGCTTTTTGCCCT No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589329_1203589338 11 Left 1203589329 Un_KI270747v1:40579-40601 CCCGAAGCCACGGCTTTTTGCCC No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589327_1203589338 13 Left 1203589327 Un_KI270747v1:40577-40599 CCCCCGAAGCCACGGCTTTTTGC No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589325_1203589338 29 Left 1203589325 Un_KI270747v1:40561-40583 CCGCTGCAGCTTTTTGCCCCCGA No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589334_1203589338 -10 Left 1203589334 Un_KI270747v1:40600-40622 CCTCACCGCTGCGGCTTTTTGCA No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589328_1203589338 12 Left 1203589328 Un_KI270747v1:40578-40600 CCCCGAAGCCACGGCTTTTTGCC No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data
1203589331_1203589338 4 Left 1203589331 Un_KI270747v1:40586-40608 CCACGGCTTTTTGCCCTCACCGC No data
Right 1203589338 Un_KI270747v1:40613-40635 GCTTTTTGCACCCACAGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203589338 Original CRISPR GCTTTTTGCACCCACAGCCG GGG Intergenic
No off target data available for this crispr