ID: 1203601447

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270748v1:12618-12640
Sequence CTTTCCCCCATCGCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203601447_1203601452 29 Left 1203601447 Un_KI270748v1:12618-12640 CCCGAGGCTGCGATGGGGGAAAG No data
Right 1203601452 Un_KI270748v1:12670-12692 TTCCCACAATATGGCTGTGAAGG No data
1203601447_1203601451 20 Left 1203601447 Un_KI270748v1:12618-12640 CCCGAGGCTGCGATGGGGGAAAG No data
Right 1203601451 Un_KI270748v1:12661-12683 CTGAGGTGTTTCCCACAATATGG No data
1203601447_1203601449 3 Left 1203601447 Un_KI270748v1:12618-12640 CCCGAGGCTGCGATGGGGGAAAG No data
Right 1203601449 Un_KI270748v1:12644-12666 AATTCCAGCACATACTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203601447 Original CRISPR CTTTCCCCCATCGCAGCCTC GGG (reversed) Intergenic
No off target data available for this crispr