ID: 1203602302

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270748v1:25149-25171
Sequence ATACAGAAAAGGAAAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203602302_1203602307 11 Left 1203602302 Un_KI270748v1:25149-25171 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1203602307 Un_KI270748v1:25183-25205 ATTAACTTAGTGGTTACCATGGG No data
1203602302_1203602308 12 Left 1203602302 Un_KI270748v1:25149-25171 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1203602308 Un_KI270748v1:25184-25206 TTAACTTAGTGGTTACCATGGGG No data
1203602302_1203602305 1 Left 1203602302 Un_KI270748v1:25149-25171 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1203602305 Un_KI270748v1:25173-25195 TTCAAAAGATATTAACTTAGTGG No data
1203602302_1203602306 10 Left 1203602302 Un_KI270748v1:25149-25171 CCCTCTGCTTTCCTTTTCTGTAT No data
Right 1203602306 Un_KI270748v1:25182-25204 TATTAACTTAGTGGTTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203602302 Original CRISPR ATACAGAAAAGGAAAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr