ID: 1203603828

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270748v1:40994-41016
Sequence ATGGCTCCACACTGCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203603828_1203603831 8 Left 1203603828 Un_KI270748v1:40994-41016 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1203603831 Un_KI270748v1:41025-41047 TCTGCCGCGCACCCAGCAGTCGG No data
1203603828_1203603833 14 Left 1203603828 Un_KI270748v1:40994-41016 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1203603833 Un_KI270748v1:41031-41053 GCGCACCCAGCAGTCGGCTGTGG No data
1203603828_1203603834 15 Left 1203603828 Un_KI270748v1:40994-41016 CCAAGATGGCAGTGTGGAGCCAT No data
Right 1203603834 Un_KI270748v1:41032-41054 CGCACCCAGCAGTCGGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203603828 Original CRISPR ATGGCTCCACACTGCCATCT TGG (reversed) Intergenic
No off target data available for this crispr