ID: 1203611340

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:8567-8589
Sequence ACTTATATGCTGACTGTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1203611340_1203611341 3 Left 1203611340 Un_KI270749v1:8567-8589 CCGTGTACAGTCAGCATATAAGT No data
Right 1203611341 Un_KI270749v1:8593-8615 ATAACAGAAGATTACCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203611340 Original CRISPR ACTTATATGCTGACTGTACA CGG (reversed) Intergenic
No off target data available for this crispr