ID: 1203612277

View in Genome Browser
Species Human (GRCh38)
Location Un_KI270749v1:20863-20885
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1029
Summary {0: 6, 1: 74, 2: 130, 3: 296, 4: 523}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1203612277 Original CRISPR GCTCAGAGGAGACCCATAGT GGG Intergenic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
903031116 1:20465061-20465083 CCTCAGAGAAGACCCAGAGAGGG + Intergenic
903101820 1:21036277-21036299 GCTCAGAGGAGACCTGCAGTGGG - Intronic
903930972 1:26862373-26862395 GCTCAGAGGGGACCCTGAGGGGG + Intergenic
904365694 1:30009808-30009830 GCTCAGAGAAGACCCACAGTGGG + Intergenic
904443832 1:30551475-30551497 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
904551817 1:31325147-31325169 GCAGAGAGGAGACCCAGAATGGG - Intronic
904551827 1:31325215-31325237 GCTCTCAGGAGACCCAAAGTAGG - Intronic
905546150 1:38801901-38801923 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
906051775 1:42880474-42880496 GCTCTCAGGAGACCCAATGTAGG + Intergenic
906051786 1:42880542-42880564 GAAGAGAGGAGACCCAGAGTGGG + Intergenic
906448203 1:45921984-45922006 GCTTAGAGGGGACCCGCAGTGGG + Intronic
906472910 1:46146014-46146036 GCTCAGAGAAGAGCCAAAGCCGG + Intronic
907252971 1:53155319-53155341 GTTCAGAGGAGACCCTCAGCGGG - Intergenic
907761872 1:57368662-57368684 GCTCAGAGGAGACCTGCAGTGGG - Intronic
907914998 1:58860534-58860556 AGTCAGAGGAGAGACATAGTCGG - Intergenic
907985383 1:59524742-59524764 GCTCTCAGAAGACCCAAAGTGGG - Intronic
908259273 1:62327148-62327170 GCTCAGAGGAGACCCACAGTGGG + Intergenic
909054590 1:70806676-70806698 GTGCAGAGGAGACCTAAAGTGGG + Intergenic
909282360 1:73771177-73771199 GCTCAGAGAAAACCCTCAGTGGG - Intergenic
909599666 1:77448388-77448410 GCGGAGAGGAGACCCAGAGTGGG - Intronic
910602090 1:89043205-89043227 GCTCAGAGGAAACCCACAGTGGG + Intergenic
910654903 1:89609655-89609677 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
910840025 1:91552599-91552621 GCTTAGAGGAGAGCCACAGAAGG - Intergenic
911004100 1:93199732-93199754 GCTCAGAGGAGACCCACAGTGGG + Intronic
911025089 1:93427387-93427409 GCTTAGAGGAGGCCCACAGTAGG - Intergenic
911025729 1:93434200-93434222 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
911025759 1:93434398-93434420 GCAGAGAGGAGACCCAGAATGGG + Intergenic
911025784 1:93434538-93434560 GTGGAGAGGAGACCCAGAGTAGG + Intergenic
911050923 1:93670487-93670509 GCTCAGAGGATGCCCACAGCTGG + Intronic
911275616 1:95854175-95854197 GCTCAGAGAACACCCACAGTGGG - Intergenic
911540093 1:99147135-99147157 GCTCAGAAGAGACACACAATGGG - Intergenic
911935136 1:103960509-103960531 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912013718 1:105005422-105005444 GCAGAGAGGAGACCCTCAGTGGG + Intergenic
912062115 1:105686645-105686667 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912094506 1:106121492-106121514 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
912459355 1:109820630-109820652 TGTCAGAGCAGACCCTTAGTGGG + Intergenic
915200253 1:154221457-154221479 GATCAGAGGAGGCCCGCAGTGGG - Intronic
916944530 1:169712629-169712651 GATCAGAGCAGAACCATAGGAGG + Intronic
917848787 1:179042779-179042801 GTGGAGAGGAGACCCACAGTGGG + Intronic
918757341 1:188355502-188355524 GCAAAGAGGAGACCCATAGTGGG + Intergenic
918963167 1:191306414-191306436 GCTCAGAGGAGAGCCGCACTGGG + Intergenic
918983630 1:191595814-191595836 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
919083203 1:192891136-192891158 GCTCAGAGGAGACCCACGGTGGG + Intergenic
919253950 1:195097009-195097031 GCTCTCAGGAGACCCATAGAGGG - Intergenic
919513390 1:198493863-198493885 GCTCAGAGGAGACCCACAGTGGG + Intergenic
919750045 1:201031851-201031873 GCTCAGAGGGGACTCAGAGGGGG + Intergenic
920944110 1:210512203-210512225 GCTCAGGGCAGACCCAGAGATGG + Intronic
921675262 1:217968971-217968993 GCCAAGAGGAGATCCAGAGTGGG - Intergenic
921675283 1:217969108-217969130 GCTCTCAGGAAACCCAAAGTGGG - Intergenic
922041637 1:221903586-221903608 GCTCAGAGAAGACCCACATGGGG + Intergenic
922505924 1:226125596-226125618 GCCCAGAGGAAATCCATAGGTGG + Intergenic
922861361 1:228819083-228819105 GCTCAGAGGAGATCCTCAGTGGG - Intergenic
923328185 1:232898859-232898881 GCAGAGAGGAGACCCACAGTGGG - Intergenic
923328205 1:232899005-232899027 GCTCTCAGGTGACCCAAAGTGGG - Intergenic
924404643 1:243730283-243730305 GCAGAGAGGAGACCCAAAGCGGG - Intronic
924673101 1:246148421-246148443 GCTCAGAGGAAGCCCACTGTGGG - Intronic
924679982 1:246221264-246221286 ACTCAGAGAAAACCCACAGTGGG - Intronic
1062771387 10:104433-104455 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1064010359 10:11730485-11730507 GCTCTCAGGAGACTCAAAGTGGG - Intergenic
1064566309 10:16642330-16642352 GCTCTGCGGAGACCCACAGAGGG + Intronic
1064798106 10:19036744-19036766 GCTCAGGGGAGACACTTAGATGG - Intergenic
1065201424 10:23316696-23316718 GCTAAGAGAAGACCCACAGTGGG + Intronic
1065407923 10:25389492-25389514 GCTCAGAGGAGATCTGCAGTGGG - Intronic
1065830355 10:29609080-29609102 GCTGTCAGGAGACCCAAAGTGGG - Intronic
1066101501 10:32122287-32122309 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1066188913 10:33037436-33037458 GCTCTCAGGAGACCTACAGTGGG - Intergenic
1067258667 10:44667038-44667060 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1068137466 10:52965080-52965102 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1068157645 10:53222434-53222456 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1068283615 10:54908678-54908700 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1068287692 10:54961704-54961726 GTACAGAGGAGACCCAAAGTGGG - Intronic
1068287725 10:54961925-54961947 GTGTAGAGGAGACCCAAAGTGGG - Intronic
1068290961 10:55001127-55001149 GCAGAGAGGAGACCCAGAGTGGG - Intronic
1068290972 10:55001197-55001219 GCTCTCAGGAGACCCGAAGTGGG - Intronic
1068300417 10:55131620-55131642 GCTCTTAAGAGACCCAAAGTGGG + Intronic
1068474449 10:57507319-57507341 GTGGAGAGGAGACCCATAGGGGG - Intergenic
1068474472 10:57507481-57507503 GCTCTTAGGAGACCCGAAGTGGG - Intergenic
1068919281 10:62465653-62465675 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1068938470 10:62658178-62658200 GTGGAGAGGAGACCCATGGTGGG - Intronic
1068938481 10:62658248-62658270 GCTCTCAGGAGACACAAAGTGGG - Intronic
1069212553 10:65779734-65779756 GCTTTCAGGAGACCCAAAGTGGG - Intergenic
1069561738 10:69435601-69435623 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
1069753714 10:70760913-70760935 GCTCAGAGGACACACATAGCAGG + Exonic
1070093343 10:73311401-73311423 GCTCTGAGGAGACAAATATTAGG - Intronic
1070096161 10:73340143-73340165 GAAGAGAGGAGACCCACAGTGGG + Intronic
1070096183 10:73340283-73340305 GCAGAGAGGAGACCCACAGTGGG + Intronic
1070173515 10:73950927-73950949 GCCCAGAGGAGACACAGACTGGG - Intergenic
1070201141 10:74207507-74207529 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1070401357 10:76056169-76056191 GCAGAGAGGAGACCCAGAGTGGG + Intronic
1070517124 10:77218536-77218558 GCTCAGAGGAGACTTCTACTGGG - Intronic
1070835145 10:79443354-79443376 TCTCAGGGGAGACCCACAGGTGG + Intronic
1071060845 10:81570041-81570063 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1071166751 10:82816335-82816357 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071166763 10:82816405-82816427 GCAGAGAGGAGACCCAAAGTGGG + Intronic
1071819318 10:89264322-89264344 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1071819366 10:89264597-89264619 GCAGAGAGGACACCCAGAGTGGG + Intronic
1072154680 10:92714277-92714299 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1072335494 10:94394890-94394912 GCTCGGAAGAGACCCACAGTGGG + Intergenic
1072470150 10:95706392-95706414 GCTCAGAGGAGACCCTCAGTGGG + Intergenic
1072838502 10:98743269-98743291 GCTTAGAAGAGACCCATTCTTGG - Intronic
1072871278 10:99123898-99123920 GTGGAGAGGAGACCCAGAGTGGG + Intronic
1072871285 10:99123968-99123990 GCAGAGAGGAGACCCAGAGTGGG + Intronic
1073260670 10:102188105-102188127 GCTCAGGGGAGACGCACAGTGGG + Intergenic
1073447959 10:103592326-103592348 GGGTAGTGGAGACCCATAGTGGG - Exonic
1073792512 10:106954846-106954868 GTGGAGAGGAGACCCAAAGTGGG - Intronic
1074247901 10:111713392-111713414 GCTCAGGGGAGACCCACAGTGGG + Intergenic
1074301762 10:112240006-112240028 GCTCTCAGGAGACCCAAAATGGG + Intergenic
1075007884 10:118843499-118843521 GCTCAGAGGAAACCTACAGGGGG - Intergenic
1075295499 10:121271652-121271674 ACTCAGGGAAGACCCCTAGTCGG + Intergenic
1076034569 10:127188339-127188361 TCACTGAGCAGACCCATAGTAGG + Intronic
1076791260 10:132777939-132777961 GCTCAGAGGTGACCCAATGCTGG - Intronic
1077488912 11:2851505-2851527 GCTCAGAGGAGGTCCTGAGTAGG - Intergenic
1077844661 11:6012243-6012265 GCTCAGAGAAGACCTGAAGTGGG + Intergenic
1077938893 11:6818690-6818712 CCTCTCAGGAGACCCAGAGTGGG - Intergenic
1078042714 11:7883616-7883638 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1078345509 11:10544530-10544552 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1078836364 11:15034637-15034659 GCTCAGAGGAGACCTACAGTGGG + Intronic
1079503911 11:21132957-21132979 GCTCTCAGGAGACCCGAAGTAGG + Intronic
1079710657 11:23679556-23679578 GCTCAGGGAAGACCCGCAGTGGG + Intergenic
1079997004 11:27305297-27305319 GTGGAGAGGAGACCCACAGTGGG - Intergenic
1080405429 11:31974560-31974582 GCTCAGAGGCCACCCATGCTGGG - Intronic
1080583919 11:33665255-33665277 GCTCAGAGGAGACCCACAGTGGG + Intronic
1080597229 11:33784162-33784184 GCTGAGAGTAGACCAAAAGTGGG - Intergenic
1080706723 11:34701949-34701971 GCAGAGAGGAGATCCAGAGTGGG - Intergenic
1080851949 11:36077992-36078014 GCTCAGAGGAGACTCACAGTGGG + Intronic
1081010953 11:37812037-37812059 GCTCCCAGGAGACCCAAAATGGG + Intergenic
1081044090 11:38250429-38250451 GTAGAGAGGAGACCCATAGTGGG + Intergenic
1081283970 11:41245836-41245858 CCTTAGAGGAGACCCATAGTGGG + Intronic
1081490072 11:43560765-43560787 GCTCAGAAGAGCTCCATGGTTGG - Intronic
1081767322 11:45620758-45620780 GCTCTCAGGAGACCAAAAGTGGG + Intergenic
1081767343 11:45620896-45620918 GCAGAGGGGAGACCCAGAGTGGG + Intergenic
1082661704 11:55920174-55920196 GCAGAGAGGAGACCTAGAGTGGG - Intergenic
1083066729 11:59931748-59931770 GCTCAGTGGAGACCAACAGTAGG + Intergenic
1084261901 11:67984292-67984314 GCTCTTAGGAGACCCATCGCAGG - Intergenic
1084469443 11:69348492-69348514 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1085212151 11:74791156-74791178 GCTGAGAGGAGATCCACAGTGGG + Intronic
1085390952 11:76181901-76181923 GCTCAGAGGAGGCCAAGAGGTGG - Intergenic
1085435215 11:76493632-76493654 GCTGAGAGAAGACCCACAGTGGG - Intronic
1085496912 11:76978417-76978439 GTGGAGAGGAGACCCAGAGTGGG - Intronic
1085496925 11:76978487-76978509 GCTCTTGGGAGACCCAAAGTGGG - Intronic
1086249345 11:84795217-84795239 GCAAAGAGGAGACCCACAGTGGG - Intronic
1086249385 11:84795494-84795516 GCTCAGAGGAGACCTGCAGTGGG - Intronic
1086508257 11:87528381-87528403 GCTCTGAGGAGACCTACAGTGGG + Intergenic
1086947036 11:92853701-92853723 GCAGAAAGGAGACCCACAGTGGG + Intronic
1087211012 11:95446598-95446620 GCTCAGAGGAGACCCACATTGGG + Intergenic
1087338874 11:96877947-96877969 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1087338883 11:96878017-96878039 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1087442856 11:98208052-98208074 GCGCAGTGGAGACCCAAAGTGGG + Intergenic
1087453402 11:98353245-98353267 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1087534356 11:99424920-99424942 GCTCAGAGGAAACTCAAAGTGGG + Intronic
1087534364 11:99424990-99425012 GCAGAGAGGAAACCCATAGTGGG + Intronic
1088135707 11:106553011-106553033 GCTCAGAGGAGACCTGCAGGGGG - Intergenic
1088287948 11:108206994-108207016 ACAGAGAGGAGACCCACAGTGGG + Intronic
1088513347 11:110600021-110600043 GCTCAGAGGAGACCCACAGGGGG - Intronic
1088651183 11:111959020-111959042 GCTCAGAGGAGACGTGCAGTGGG - Intronic
1088704218 11:112447480-112447502 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1089270472 11:117298523-117298545 GCTCAGAGAAGACCTATTCTAGG + Intronic
1089822450 11:121241008-121241030 GCTCAGAAGAGACCCGCAGTGGG + Intergenic
1089823225 11:121246979-121247001 GAACAGAAGAGACCCACAGTGGG - Intergenic
1090124842 11:124075150-124075172 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1090136970 11:124209313-124209335 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1090836244 11:130456098-130456120 GCACAGAAGAGACCCAGAGAAGG - Intronic
1090910096 11:131111187-131111209 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1092271995 12:7030883-7030905 GCTCTCAGGAGACCTGTAGTGGG + Intronic
1092272010 12:7030957-7030979 GTGGAGAGGAGACCCATGGTGGG + Intronic
1092324134 12:7511160-7511182 GATCAGAGGAGTCTCAGAGTTGG + Intergenic
1092447044 12:8567617-8567639 GCTCAGAGAAAATCCACAGTGGG + Intergenic
1092508163 12:9125227-9125249 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1093059542 12:14588850-14588872 GCTCAGAGGAGAGCCGCAGTGGG + Intergenic
1093502392 12:19827803-19827825 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
1093765131 12:22953676-22953698 GCCAAGAGGAGACCCAGAGTAGG + Intergenic
1094175468 12:27536798-27536820 GCTCAGAAAAGACCCACAGTTGG - Intronic
1094427359 12:30328755-30328777 GCTCGGAGGATACCTGTAGTGGG - Intergenic
1095042373 12:37456367-37456389 GCTCAGAGGAGACCCATGGTGGG - Intergenic
1095444054 12:42267427-42267449 GCGGAGAGGAGTCCCAAAGTGGG + Intronic
1095603257 12:44038006-44038028 GCTAAGAGGAGACCCTCAGTGGG - Intronic
1095826144 12:46531700-46531722 GCTCAGAGGGGAACCACAGTGGG - Intergenic
1096171951 12:49478920-49478942 GCTCAGCGGAGACCCGCAGTGGG + Intronic
1096295610 12:50381388-50381410 GCTCAGAGGAGACCCTCAGTGGG + Intronic
1096295621 12:50381458-50381480 GCAGAGAGGAGACCCACAGTGGG + Intronic
1096355494 12:50937787-50937809 GCAGAGAGGAGACCCAGAGTGGG + Intergenic
1096602928 12:52742926-52742948 GCTCAGAAGTGACCCACAGTGGG - Intergenic
1096715053 12:53486331-53486353 CCCCAGAGGAGATCCATAGGTGG - Intronic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1097076206 12:56396791-56396813 GCTCAGAAGAGACCCACAGTGGG + Intergenic
1097078126 12:56410263-56410285 GTTCAGAGGAGACCCACAGTGGG + Intergenic
1097130820 12:56809705-56809727 TCTCAGAGGAAACCCACAGGGGG + Intergenic
1097446451 12:59678373-59678395 GCTCAGAGGAGACCTGCAGTAGG + Intronic
1097491942 12:60282157-60282179 GCTCAGAAGAGACACACATTGGG + Intergenic
1097500298 12:60392810-60392832 GCTCAGAGAAGACCCACATTAGG - Intergenic
1098290825 12:68955731-68955753 GCTGAGAGGAGACCCAGAGCAGG + Intronic
1098519609 12:71420782-71420804 GCTCTCAGGACACCCACAGTGGG + Intronic
1098671398 12:73235121-73235143 GCACAGAGGAGACCCGTGGTGGG + Intergenic
1098802949 12:74985249-74985271 GCTCAGAGGAGACTTGAAGTGGG + Intergenic
1098951642 12:76645666-76645688 GCTCGGAGGAGACCCAAAGTGGG - Intergenic
1099033764 12:77560320-77560342 GCGGAGAGGAGACCCAGAGTGGG - Intergenic
1099033775 12:77560390-77560412 GCTCTCAGGATACCCAAAGTGGG - Intergenic
1099295451 12:80823068-80823090 GCTCAGAAGAGACCCACAGTGGG - Intronic
1099321989 12:81162328-81162350 GCTGAGAGGACACCCAGAGTGGG + Intronic
1099683382 12:85856728-85856750 GCAGAGAGGAGACTCATAGTGGG + Intergenic
1099693410 12:85991096-85991118 ACTCAGACAAGACCCACAGTGGG + Intronic
1099879935 12:88455666-88455688 GCCCAGAGATGACCCATGGTAGG + Intergenic
1101071069 12:101076589-101076611 CCTCAGATGAGAACCATAGAGGG + Intronic
1101086306 12:101239786-101239808 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1101668633 12:106845193-106845215 GCTTGGTGGAGACCCAGAGTAGG - Intronic
1101763938 12:107681872-107681894 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1102456523 12:113074285-113074307 GCTCAGAGGACAGCAATAGGAGG + Intronic
1103173711 12:118843923-118843945 GCAGTGAGGAGACCCAAAGTGGG - Intergenic
1104738079 12:131152201-131152223 GCGGAGAGGAGACCCACAATGGG - Intergenic
1104761216 12:131298633-131298655 GCTCAGAGGAGCCCCAGAGCTGG - Intergenic
1104805591 12:131587319-131587341 GCTCAGAAGAGACACACAGGGGG - Intergenic
1104818559 12:131662159-131662181 GCTCAGAGGAGCCCCAGAGCTGG + Intergenic
1105041924 12:132967455-132967477 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1106052029 13:26200352-26200374 GCTCAGATGAGCCCCACACTTGG + Intronic
1106308980 13:28535994-28536016 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1106379569 13:29223338-29223360 GCAAAGAGGAGGCCCACAGTGGG - Intronic
1106979070 13:35256071-35256093 GCAGAGAGGAGACCCAGAGTGGG + Intronic
1107229090 13:38086585-38086607 GCAGAGAGGAGACCCAAAGTGGG - Intergenic
1107563356 13:41577202-41577224 GGTCAGAGGAGGGCCAGAGTGGG + Intronic
1107841195 13:44459352-44459374 GCAGAGAGGATATCCATAGTGGG - Intronic
1107841206 13:44459422-44459444 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1108016968 13:46086380-46086402 GCTCAGAGGAGACTCGCGGTGGG + Intronic
1108240279 13:48457160-48457182 GCTTAGAGAAGACCCATAGTGGG + Intronic
1108249631 13:48551416-48551438 GTGGAGAGGAGACCCAGAGTGGG - Intergenic
1108542393 13:51456241-51456263 GCAGAGAGGAGACCCACAATGGG + Intergenic
1108542532 13:51456983-51457005 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1108559385 13:51627847-51627869 GCAGAGAGGAGACCCACAGTGGG + Intronic
1108787410 13:53921497-53921519 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1108847076 13:54691744-54691766 GTGAAGAGGAGACCCAAAGTGGG + Intergenic
1108854392 13:54775302-54775324 GCAGAGAGGAGGCCCACAGTAGG + Intergenic
1109008492 13:56909633-56909655 GTAGAGAGGAGACCCAAAGTGGG - Intergenic
1109348494 13:61145706-61145728 ATAGAGAGGAGACCCATAGTGGG - Intergenic
1109387178 13:61645967-61645989 GCTCAGAGAACACCAATTGTAGG - Intergenic
1109396453 13:61765976-61765998 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1109420546 13:62105946-62105968 GCTCCTAGGAGACCCAAAATGGG - Intergenic
1109438944 13:62343789-62343811 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109470694 13:62799888-62799910 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109478713 13:62919513-62919535 GCAGAGAGGAGACCCAGAGTGGG + Intergenic
1109686695 13:65830124-65830146 GCTCTCAGGAGACCCGCAGTGGG - Intergenic
1109780816 13:67107599-67107621 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1109837486 13:67878026-67878048 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1109837497 13:67878097-67878119 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1110201182 13:72851843-72851865 GCTGAGAGGAGACCCACAGTTGG - Intronic
1110201188 13:72851913-72851935 GCTGAGAGGAGACCCACAGTGGG - Intronic
1110439097 13:75507753-75507775 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1110670198 13:78168936-78168958 ACTCATGGGAGACCCACAGTGGG + Intergenic
1110778024 13:79432686-79432708 GCTCAGAGGAGACCTTCAGTGGG - Intergenic
1110939495 13:81331105-81331127 GTTCAGAGGAGACCTGTAGTGGG - Intergenic
1111002721 13:82205953-82205975 ATTCAGAGGAGACCCACATTGGG - Intergenic
1111202587 13:84959939-84959961 GCAGATAGGAAACCCATAGTGGG + Intergenic
1111202785 13:84961722-84961744 GCTCTCAGGAGACCCGTAGTGGG + Intergenic
1111202804 13:84961862-84961884 GTGGAGAGGAGACCCATAGTGGG + Intergenic
1111237818 13:85431565-85431587 ACTCAGTGGAGACCCACAGTGGG - Intergenic
1111268875 13:85854058-85854080 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1111304031 13:86382839-86382861 GCTCTCAGGAGACTCAAAGTGGG - Intergenic
1111347333 13:86975139-86975161 GAGCAGAGGAGACCCCTAGTGGG - Intergenic
1111485726 13:88896072-88896094 GCTGAGAGGAGACCCATAGTGGG - Intergenic
1111485744 13:88896210-88896232 GCTCTCAGGAGACTCAAAGTAGG - Intergenic
1111595433 13:90404474-90404496 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1111800421 13:92974459-92974481 GCTCAGAGGAGACCCACAGTAGG + Intergenic
1113339214 13:109405199-109405221 GCTCAGAGGAGACTTGCAGTGGG - Intergenic
1113970744 13:114186342-114186364 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1114349524 14:21835278-21835300 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115485050 14:33902104-33902126 ACTCAGAAGAGACTCACAGTGGG - Intergenic
1116083350 14:40204256-40204278 GCAGAAAGGAGACCCACAGTGGG + Intergenic
1116131457 14:40859651-40859673 GCTCAGAGGATATCCACAGTGGG - Intergenic
1116221645 14:42095756-42095778 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1116257275 14:42571777-42571799 CCTCAGAGGAGACCCAGAGTGGG - Intergenic
1116356778 14:43939460-43939482 GCAGAGAGGAGACTCCTAGTGGG - Intergenic
1116448513 14:45039112-45039134 GCGGAGAGGAGACCCAGAGTGGG + Intronic
1116448520 14:45039182-45039204 GCAGAGAGGAGACCCTTAGAGGG + Intronic
1116789952 14:49329669-49329691 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1116961684 14:50973654-50973676 GCAGAGAGGAGACCCAGAGTGGG - Intergenic
1117068340 14:52033005-52033027 GCTCAGAAGAGCCCCATGCTTGG - Intronic
1117285443 14:54282334-54282356 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1117734061 14:58751557-58751579 GCTCAGAGGAGACCTGCATTGGG - Intergenic
1118213491 14:63787576-63787598 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1118473068 14:66093372-66093394 GCTCACAGGAGACCCGCAGTGGG + Intergenic
1118521966 14:66595972-66595994 GCTTAAAGGAGACCCACAGTGGG + Intronic
1118521976 14:66596042-66596064 GCAGAGAGGAGACCCATAGTGGG + Intronic
1118521986 14:66596112-66596134 GCAGAGAGGAGACCCTCAGTGGG + Intronic
1119912152 14:78359408-78359430 GCTCAGAAGGGCCCCATACTTGG + Intronic
1120399186 14:84006724-84006746 GGTCAGAAGTGACCCCTAGTGGG - Intergenic
1120405780 14:84091735-84091757 GCTCAGACGAGACCCACAGTGGG - Intergenic
1120535684 14:85692096-85692118 TCCCAGAGAAGACCCATATTTGG + Intergenic
1120590083 14:86364439-86364461 GCTCAGAGGAGACCTACATTGGG - Intergenic
1121824601 14:97000222-97000244 ACTCACAGGAGATCCACAGTGGG + Intergenic
1122386039 14:101348967-101348989 GCTCCCAGGAGACCTAAAGTGGG + Intergenic
1122390413 14:101377301-101377323 CCTCAGAGGAGACCCACTTTGGG - Intergenic
1202840237 14_GL000009v2_random:114595-114617 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202909608 14_GL000194v1_random:104719-104741 GCTGAGAGGAGACGCATGGTGGG - Intergenic
1202909618 14_GL000194v1_random:104792-104814 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202883668 14_KI270722v1_random:84510-84532 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1202940900 14_KI270725v1_random:144092-144114 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1123888406 15:24749668-24749690 GCTCAGAGAAGCCCTACAGTGGG - Intergenic
1124820916 15:33044801-33044823 GCTCAGAGGAGACCTACAGTGGG - Intronic
1125241596 15:37582652-37582674 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1125718209 15:41831724-41831746 GCTCAGAGGAGACCCACAGTGGG - Intronic
1125752417 15:42037468-42037490 GCTCAGAGGAGACCCGCAGTAGG - Intronic
1125790512 15:42362003-42362025 GCTCAGGCCAGTCCCATAGTGGG + Intronic
1126215244 15:46146595-46146617 ACAGAGAGGAGACCCACAGTGGG - Intergenic
1126215251 15:46146665-46146687 GCTCAAGGGAGACCTACAGTGGG - Intergenic
1126292563 15:47099151-47099173 GCTCCGAGGAGACCCATAGTGGG + Intergenic
1127525860 15:59791689-59791711 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1128965342 15:72052335-72052357 GCTCAGAGGAGACTCGCAGTGGG - Intronic
1129368990 15:75076268-75076290 GCTCAAAGGAGACCCACAGTGGG + Intronic
1129785155 15:78304856-78304878 GCTCAGAGAAGACCCGCAGTGGG - Intergenic
1129932986 15:79427897-79427919 GCTCAGAGGAGAATCAGAGAGGG + Intergenic
1130856073 15:87841158-87841180 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1131035859 15:89221688-89221710 GCTCACAGGAGGCCCTCAGTGGG + Exonic
1132795218 16:1717488-1717510 GCTCAAAGGTGACCCATAGGTGG + Intronic
1132945689 16:2530457-2530479 GCTCTGAGGACAGCCACAGTGGG + Exonic
1135057035 16:19240328-19240350 GCTCAGAGGGGACCCGTAACAGG + Intronic
1137256464 16:46778893-46778915 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1137343940 16:47637116-47637138 GCTGAGAGGAGACCCGCAGTGGG - Intronic
1137343952 16:47637186-47637208 GCTCCCAGGAGACCCAAAGTGGG - Intronic
1137486128 16:48892905-48892927 TCTCAAAGCAAACCCATAGTAGG + Intergenic
1137588658 16:49680018-49680040 GCTCAGAGGAGACCCACAGTGGG - Intronic
1137607555 16:49796678-49796700 GGTCAGAGGAGGCCTCTAGTAGG + Intronic
1137623339 16:49891568-49891590 GCTCAGAGGAGACTGGCAGTGGG + Intergenic
1137825225 16:51489220-51489242 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1138033480 16:53579765-53579787 GCCCAGAGGAGACCTGCAGTGGG + Intergenic
1139088663 16:63617990-63618012 GCAAAGAGGAGACCCACAGCGGG + Intergenic
1139138570 16:64233893-64233915 GCTCCAAGGACACCCAAAGTGGG - Intergenic
1139242196 16:65404483-65404505 GCTCAGAAGAGAGCAATGGTTGG + Intergenic
1139389968 16:66601317-66601339 GCTCAGAGGAGACTGACAGTGGG + Intergenic
1139463601 16:67142067-67142089 GTTCAGAGGAGACCCATGGTGGG + Intronic
1139463609 16:67142136-67142158 GCAGAGAGAAGACCCATAGTGGG + Intronic
1139625775 16:68187512-68187534 GCTCAGAGAAGACCCACAGAGGG + Intronic
1139700941 16:68707639-68707661 GCTGAAAGGAGACCCCTAGGAGG + Intronic
1140419506 16:74807067-74807089 GCTCAGAAGAGACCGGAAGTGGG + Intergenic
1141034449 16:80615549-80615571 GCTTACAGGAGACCCACAGCAGG - Intronic
1141606116 16:85154295-85154317 TCTCAGAGGAGACCCCAAGTGGG + Intergenic
1144078577 17:11741535-11741557 GCTTAGAGGAGACACACATTTGG + Intronic
1145881950 17:28358560-28358582 GCTCAGAGGACACTAATACTAGG - Intronic
1146086976 17:29838745-29838767 GCTCAGAGGAGACCCACAGTGGG - Intronic
1146093547 17:29906041-29906063 GCTCAGAGGAGACCCGCAGTGGG - Intronic
1146143206 17:30387939-30387961 GCTCAGAGGAGACCGGCAGTGGG + Intronic
1146425335 17:32732455-32732477 GCAGAGAGGAGACCCATGGTGGG - Intronic
1146425351 17:32732599-32732621 GCTCAGAGGAGAATCTCAGTGGG - Intronic
1149085546 17:52710753-52710775 GCTCAGAGGAAACCCACAGTGGG - Intergenic
1149238021 17:54616179-54616201 GCTTAGAGGAGACCCACGGTGGG - Intergenic
1149329907 17:55570104-55570126 GCTCAGAGAAGACCCACACTGGG - Intergenic
1149482871 17:57017743-57017765 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1149884721 17:60328452-60328474 GCTTAGAGGAGACCTGCAGTGGG - Intronic
1150281336 17:63931175-63931197 GCTCAGAGGAGATCCTAAGGAGG + Intronic
1150521096 17:65866819-65866841 GCTCAGAGGAGACCCAGAGTGGG - Intronic
1150868647 17:68880299-68880321 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1150952862 17:69822173-69822195 GCTCAGTGGAGACCTGCAGTGGG - Intergenic
1151009997 17:70483579-70483601 GCCCAGAGGAGACCTGTAGTGGG + Intergenic
1151395245 17:73819040-73819062 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1151773147 17:76177973-76177995 GCTCAGAGGATACCCGCAGTGGG - Intronic
1152530515 17:80915976-80915998 GCTCAGAGGAGACCCACAGTTGG - Intronic
1152856570 17:82668091-82668113 GCTCAGGGGAGACCCACAGTGGG + Intronic
1152864162 17:82712374-82712396 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
1153139307 18:1954179-1954201 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1153428764 18:4992831-4992853 GCTCCTAGGAGACCCAAAGTTGG + Intergenic
1153608218 18:6855465-6855487 GCTCTTAGGAGACCCCTGGTGGG - Intronic
1154346569 18:13548098-13548120 GCAGAGAGGAGACCCAGAGTGGG + Intronic
1154357467 18:13632895-13632917 TCAGAGAGGAGACCCACAGTGGG + Intronic
1154357486 18:13633013-13633035 GCAGAGAGGAGACCCATAGAGGG + Intronic
1155120631 18:22815963-22815985 GCTCAGAGGAGACCTGCAGTGGG + Intronic
1155215799 18:23641985-23642007 GTGGAGAGGAGACCCATAGTGGG - Intronic
1155215811 18:23642055-23642077 CCTCCCAGGAGACCCAAAGTGGG - Intronic
1156160409 18:34351535-34351557 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1156298732 18:35817437-35817459 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1157006382 18:43589425-43589447 GCTCAGAGGAGAGCCACAGTGGG + Intergenic
1157042847 18:44060837-44060859 GCTCAGAGAAGACCCACAGTAGG + Intergenic
1157506704 18:48231463-48231485 GCAGAGAGGAGACCCACAGTGGG - Intronic
1157691160 18:49682894-49682916 GCTCACAGGACACCCATACTGGG - Intergenic
1158023336 18:52869267-52869289 GCTCAGAGGAGACCCACAGTAGG + Intronic
1158139401 18:54241395-54241417 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1158633045 18:59132661-59132683 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1158788061 18:60740042-60740064 GCTGAGAAGATACCCAGAGTGGG - Intergenic
1159161296 18:64646439-64646461 GCTCTCAGGGGACCCAAAGTAGG + Intergenic
1159189025 18:65017586-65017608 GCTCAGAGGAGACTCGCAATGGG + Intergenic
1160879050 19:1311246-1311268 GCTGAGAGGGGACCCCTGGTGGG - Intergenic
1161026590 19:2039963-2039985 GCTCAGAGGAGCCCCAGGGTGGG - Intronic
1161169997 19:2807842-2807864 GCTCCGAGGAGACCCAGGGCCGG - Intronic
1162231658 19:9271364-9271386 GCTTAGAGGAGACCCACAGTGGG - Intergenic
1162417235 19:10545123-10545145 GCCCAGAGGTGAGCCATAGGGGG + Exonic
1164984471 19:32638359-32638381 GCTCTCAGGAGACCCACAGTGGG - Intronic
1165022700 19:32936931-32936953 GTTCAGAGGAGACCCACAGTGGG - Intronic
1165663281 19:37601818-37601840 GCTCAGAGCAGATTCAGAGTGGG + Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1166898188 19:46037039-46037061 GCTCAGAAGAGACCCACAGTGGG - Intergenic
1167013223 19:46822400-46822422 GCTCAGAGGAGACCGTCAGTGGG - Intergenic
1167066105 19:47187242-47187264 GCTCAGAGGAGTGACATAGCTGG - Intronic
1167235115 19:48309513-48309535 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1167346290 19:48947449-48947471 GCTCAGGGGAGACCCGCAGTGGG - Intergenic
1167469729 19:49668943-49668965 GCACAGAGGAGCCCCAGAGAAGG + Intronic
1168516748 19:57015559-57015581 ACTCAGTGCTGACCCATAGTGGG + Intergenic
1168633440 19:57975304-57975326 GCACAGGGGAGACCCACAGCAGG + Intergenic
1168714790 19:58520343-58520365 GCTCAGGGGAGGCCCAGAGCAGG - Intronic
1202632820 1_KI270706v1_random:15962-15984 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1202653058 1_KI270707v1_random:24087-24109 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1202659093 1_KI270708v1_random:51658-51680 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
924963932 2:58315-58337 GCTCAGAGGAGACCCACAGGTGG - Intergenic
925067973 2:943888-943910 GCTCAGAGGACACCCGCAGGGGG + Intergenic
926554595 2:14342076-14342098 GCTCAGAGGAGACCCGCAATGGG - Intergenic
926953626 2:18271302-18271324 GCTCAGAGGAGAAACGCAGTGGG + Intronic
928182664 2:29080555-29080577 GTGGAGAGGAGACCCATAGTGGG + Intergenic
928225538 2:29445077-29445099 GCTCAGGGGAGACACACAATGGG - Intronic
928429799 2:31207903-31207925 ACTCAGAGCAGAACCACAGTGGG - Intronic
928470235 2:31568420-31568442 GCTCTCGGGAGACCCAAAGTGGG + Intronic
928637921 2:33266735-33266757 GCTCTCAGGATACCCACAGTGGG - Intronic
928723548 2:34147165-34147187 GCTCAGAGGAGTCCTGCAGTGGG + Intergenic
928820478 2:35355598-35355620 GCTCTCAGGAGACACAAAGTGGG + Intergenic
928823464 2:35391406-35391428 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
929847093 2:45541622-45541644 GCAGAGAGGAGACCCACAGTGGG + Intronic
929847119 2:45541761-45541783 GCAGAGAGCAGACCCAAAGTGGG + Intronic
930313585 2:49771596-49771618 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
930612073 2:53554603-53554625 GCTCAGAGGAAACCTGCAGTAGG - Intronic
930684795 2:54296370-54296392 ACTCTGAGGGGACCAATAGTTGG + Intronic
930729058 2:54709921-54709943 GCTCAGAGGAGACCCGCAGTAGG - Intergenic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
930957315 2:57217934-57217956 ACTCAGAGGAGACCTACATTGGG - Intergenic
930971147 2:57397362-57397384 GCTCCGAGGAGACCTGCAGTGGG + Intergenic
930971156 2:57397431-57397453 GCAGAGAGGAGACACACAGTGGG + Intergenic
931300546 2:60974165-60974187 GTTCAGAGAAGACCCACAGTGGG - Intronic
931418810 2:62106530-62106552 GATCAGAGGAGACCCTGAATGGG + Intronic
931500131 2:62856038-62856060 GCTCAGAGGAGACTCGCAGTGGG - Intronic
932054670 2:68432294-68432316 GCTCAGAGGAGAACCACAGTAGG + Intergenic
932501596 2:72187478-72187500 GCTCAGAGATGACCCACAGTGGG + Intronic
933093352 2:78147135-78147157 GCTCAGAAGACACCCGCAGTGGG - Intergenic
933113104 2:78429634-78429656 GCTCAGAGGAGACTCACAGTGGG - Intergenic
933383773 2:81583984-81584006 GATCAGAGGAGACCCGCAGTGGG - Intergenic
933420888 2:82043698-82043720 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
933454955 2:82508393-82508415 GTTCTCAGGAGACCCAAAGTCGG - Intergenic
933606485 2:84389621-84389643 GCTCTCAGGAGACCCAAAGTTGG + Intergenic
935667588 2:105525859-105525881 GCTCTCAAGAGACCCAAAGTAGG - Intergenic
937163981 2:119794893-119794915 GCTCAGAGGAGACCTGCAGTGGG + Intronic
937370802 2:121296044-121296066 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
937737874 2:125313527-125313549 GCAGAGAGGATACCCACAGTAGG - Intergenic
937737884 2:125313597-125313619 GCTCTCAGGAGACCCACAGTGGG - Intergenic
937976361 2:127584369-127584391 TCCAAGAGGAGACCCATAGCAGG - Intronic
938180607 2:129178947-129178969 GCTCAGAGGAAACCCTCAGGGGG + Intergenic
938732526 2:134157956-134157978 GCTGAGGGGAGACCCACAGTGGG + Intronic
939870473 2:147520767-147520789 GCTCAGTGGAGAACCATACAAGG + Intergenic
940422799 2:153499248-153499270 GCTCTCAGGAGACCCAAAATGGG + Intergenic
940694212 2:156959030-156959052 GCTCAGAAGAGACCCACAGTGGG + Intergenic
940711165 2:157165066-157165088 GCAGAGGGGAGACCCATAGTGGG + Intergenic
940956916 2:159738526-159738548 GCTCTCAGGAGACCCAAAGTGGG + Intronic
941043664 2:160649400-160649422 GCTCAGAGGAGACCCGCAATGGG - Intergenic
941404848 2:165075053-165075075 GCAGAGAGGAGACCCAGAGTGGG - Intergenic
941929178 2:170923947-170923969 GTATAGAGGAGACCCAAAGTGGG + Intergenic
941929188 2:170924003-170924025 GTATAGAGGAGACCCAAAGTGGG + Intergenic
941998914 2:171627122-171627144 GCTCTCAGGAGACCCAAAATGGG - Intergenic
942053431 2:172162096-172162118 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
942136349 2:172930033-172930055 GCTTTGTGGAGACACATAGTGGG + Intronic
942585000 2:177466023-177466045 GCTCAGAGGAGACTCATATTGGG + Intronic
943064137 2:183069396-183069418 GCAGAGATGAGACCCAGAGTGGG - Intergenic
943191027 2:184680109-184680131 GCAGACAGGAGACCCACAGTGGG - Intronic
943191046 2:184680245-184680267 GCAGAGAGGAGACCCGCAGTGGG - Intronic
943191058 2:184680315-184680337 GCAGAGAGGAGACCCACAGTGGG - Intronic
943191077 2:184680451-184680473 GCAGTGAGGAGACCCATAGTGGG - Intronic
943345601 2:186734228-186734250 GCAGAGAGGAGACCTAGAGTGGG + Intronic
943345611 2:186734296-186734318 GCAGAGAGGAGACCCAGAGCGGG + Intronic
943426954 2:187749630-187749652 GCTCAGAGGAGACTCACAGTGGG + Intergenic
943526325 2:189021215-189021237 GCTCAGATGAGACCCACGGTGGG - Intergenic
943928460 2:193819388-193819410 GTTCTCAGGAGACCCACAGTAGG + Intergenic
943932194 2:193868358-193868380 GAACTGAGGAGACCCAAAGTGGG - Intergenic
943932212 2:193868482-193868504 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
943960268 2:194254775-194254797 GCTCTCAGAAGACCCAAAGTGGG - Intergenic
943965592 2:194328082-194328104 GCTGAGAGAAGACCCAAAATAGG - Intergenic
944146793 2:196514769-196514791 GCTCTCAGGAGACTCAGAGTGGG - Intronic
944383829 2:199141902-199141924 GCTCAAAGGAGACCCACGGTGGG - Intergenic
944483877 2:200182834-200182856 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
944489580 2:200244456-200244478 GCTCAGAGGAGAAACAGACTTGG + Intergenic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
945174889 2:207033426-207033448 GCTCAGAATAGAGCCAAAGTGGG - Intergenic
945721358 2:213421866-213421888 ACAGAGAGGAGACCCAGAGTGGG - Intronic
945721370 2:213421936-213421958 GCTCTCAGGAGACCCAAAGTGGG - Intronic
946158931 2:217824361-217824383 GCTCACAGGACACCCAGAGCTGG + Intronic
946197373 2:218043098-218043120 GCTCGGAGGAGACCTGCAGTAGG + Intronic
946495623 2:220192678-220192700 GCAGAGAGGACACCCACAGTGGG - Intergenic
947054782 2:226087821-226087843 GAGGAGAGGAGACCCATAGTGGG + Intergenic
947316731 2:228866775-228866797 GCTCAGAGGAGACCTGCACTGGG - Intronic
948008029 2:234626793-234626815 GATCAGAAGAGACCCAGAGATGG - Intergenic
948144034 2:235694970-235694992 GCTGAGCGGAGCTCCATAGTTGG + Intronic
948293550 2:236845003-236845025 GCTCAGAGGAGACCCACAGTAGG + Intergenic
948318544 2:237049934-237049956 GCTCAGTGGAGTCCCTGAGTTGG - Intergenic
948334890 2:237200212-237200234 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
948434598 2:237944495-237944517 GCTCTCAGGAGACCCAGAGTGGG - Intergenic
948575347 2:238946369-238946391 GCTCAGAGGAGACCCACAGTGGG + Intergenic
948713046 2:239837090-239837112 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1169421550 20:5464807-5464829 GCAGAGAGGAGACCCAAAGTGGG - Intergenic
1169880533 20:10341853-10341875 GCAGAGAGGAGACTCAGAGTGGG - Intergenic
1170004232 20:11647480-11647502 GCTCAGAGGAAACCTTTAGCAGG - Intergenic
1170043802 20:12065121-12065143 GCTCAGAGGAAACCCACAGGGGG + Intergenic
1170221608 20:13947446-13947468 GCTTTCAGGAGACCCAAAGTGGG - Intronic
1170314884 20:15031491-15031513 GCTCTCAGGAAACCCATAGTGGG + Intronic
1170314897 20:15031561-15031583 GCAGAGAGGGGACCCATACTGGG + Intronic
1170458415 20:16554469-16554491 GCTCAAAGGAGACCCGCACTGGG - Intronic
1170587509 20:17745821-17745843 GCTAGGAGGACACCCACAGTGGG + Intergenic
1171536805 20:25899440-25899462 GCTCAGAGGAGATCCATAGTGGG - Intergenic
1171804305 20:29661717-29661739 CCTCAGAGGAGACCCATAGTGGG + Intergenic
1171839747 20:30194705-30194727 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1173207555 20:41006789-41006811 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1173740121 20:45394443-45394465 GAGGAGAGGAGACCCAAAGTGGG - Intronic
1175064417 20:56272898-56272920 GCTCAGGGGAGACCTGCAGTGGG - Intergenic
1175065146 20:56277791-56277813 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1175138598 20:56843044-56843066 GCGGAGAGGAGACCCACAGTGGG - Intergenic
1175138610 20:56843114-56843136 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1175312845 20:58023989-58024011 GCAGAGAGGAGACTCACAGTGGG + Intergenic
1175740483 20:61416693-61416715 GCTCAGACCAGACCCATTGAAGG + Intronic
1175773351 20:61637375-61637397 CCTCAGAGGAGATCCAGGGTGGG - Intronic
1175959878 20:62630644-62630666 GCTCAGAGGAGACCCGCCGTGGG + Intergenic
1176104631 20:63380185-63380207 GCTCAGAGGCGACCCGCAGTGGG - Intergenic
1176408471 21:6434666-6434688 GCTCTGAGGAAACCCACAGGGGG - Intergenic
1176582259 21:8542849-8542871 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1176599095 21:8775564-8775586 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
1176628958 21:9119427-9119449 GCTGAGAGGAGACGCACGGTGGG - Intergenic
1176628968 21:9119500-9119522 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1176645034 21:9341842-9341864 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1176973219 21:15289847-15289869 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1176976559 21:15327577-15327599 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1176993074 21:15521867-15521889 GTTCAGAGGAGACCTGTAGTTGG + Intergenic
1176993092 21:15522007-15522029 GTAGAGAGGAGACCCACAGTGGG + Intergenic
1177037352 21:16060545-16060567 GCTCTCAGGAGATCCAAAGTGGG + Intergenic
1177262644 21:18750330-18750352 GCTCAGAGGAGACCCACAGTAGG - Intergenic
1177357780 21:20031385-20031407 CCTCAGAGGAGACCCACAGTGGG + Intergenic
1177396038 21:20537753-20537775 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1177404365 21:20646103-20646125 GTGGAGAGGAGACCCAGAGTGGG - Intergenic
1177624835 21:23646391-23646413 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1177875349 21:26625642-26625664 GCTCTAAGGAGACCTAGAGTGGG + Intergenic
1178086376 21:29115753-29115775 GCTCAGAGGGGTCCCACACTTGG - Intronic
1178244447 21:30937065-30937087 GCTCAGAAGAGACCTGCAGTGGG - Intergenic
1178937446 21:36875498-36875520 GCGAAGAGGAGACCCATGGTGGG - Intronic
1179683964 21:43042992-43043014 GCTCTGAGGAAACCCACAGGGGG - Intergenic
1180178869 21:46108955-46108977 GCTCACAGGAGACCCGCAGGGGG + Intronic
1180265094 22:10519897-10519919 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1180367917 22:11957392-11957414 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1180378171 22:12113944-12113966 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1180419335 22:12799337-12799359 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1183024922 22:35057891-35057913 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1184173924 22:42775302-42775324 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184560431 22:45259926-45259948 GCCCAGAGCTGACACATAGTAGG + Intergenic
1184665743 22:45988036-45988058 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1184865786 22:47201298-47201320 GCTCAGAGAAGACCCACAGGGGG + Intergenic
949884210 3:8681376-8681398 GCTCTGAGGACACCCATCGCAGG + Intronic
949996222 3:9619445-9619467 GCAGAGAGGGGACCCAAAGTGGG - Intergenic
950207652 3:11092905-11092927 ACTCAGAGGAGACCTGCAGTGGG - Intergenic
951034098 3:17914032-17914054 GCCCAGTGAAGACACATAGTAGG + Intronic
951182236 3:19672050-19672072 GCTCAGAGGAGACCAGCAGTGGG + Intergenic
951264665 3:20552169-20552191 GATCAGAGGAGACCTGCAGTGGG + Intergenic
951562377 3:23981764-23981786 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
952016195 3:28959579-28959601 GCTCAGAGGAGACCCAAGGTGGG - Intergenic
952269313 3:31816759-31816781 GCTCAGAGGAGACCCGTAGCGGG + Intronic
952793383 3:37217921-37217943 GCTCAGAGGAGACCGGCATTGGG - Intergenic
953289895 3:41650134-41650156 GCTCCCAGGAGACCCAAAGTGGG - Intronic
954099311 3:48357347-48357369 GCTCAGAGGAGACCCACAGTGGG + Intergenic
954157960 3:48697918-48697940 GTTCAGTTGAGGCCCATAGTCGG - Intronic
954498081 3:50983631-50983653 GCTCAGAGGAGACTCACAGTGGG - Intronic
954737066 3:52715364-52715386 GCTCAGAGGAGATCCGCAGGGGG - Intronic
955159456 3:56449389-56449411 AGTCAGAGGAGAACCAGAGTAGG + Intronic
957095286 3:75772130-75772152 GCTGAGAGGAGACCCATGGTGGG - Intronic
957095295 3:75772203-75772225 GCTCAGAGGAGACCTGCAGGGGG - Intronic
957102080 3:75840783-75840805 CCTCAAAGGTGACCCAAAGTGGG + Intergenic
957417936 3:79929869-79929891 GCTCTCAGGAGACCCACAGTGGG - Intergenic
957427075 3:80052062-80052084 GCTCAGAGGAGACTTACAGTGGG - Intergenic
957486738 3:80871262-80871284 GCAGAGAGGAGACCCGCAGTGGG - Intergenic
957636389 3:82790985-82791007 GCTCAGAGGAGGCCCACAATGGG - Intergenic
957646700 3:82939568-82939590 GCTCTCAGGGGACCCAAAGTGGG - Intergenic
957705198 3:83770823-83770845 GCTTAGAGGAGACCCACAGTGGG - Intergenic
957788000 3:84905672-84905694 GCAGAGAGGACACCCACAGTGGG - Intergenic
957788010 3:84905742-84905764 TCTCAGAGGAGACCTATACTGGG - Intergenic
958019634 3:87980355-87980377 GTGGAGAGGAGACCCAGAGTGGG + Intergenic
958141774 3:89571245-89571267 GCAGAGAGGAGACCCGGAGTGGG + Intergenic
958161187 3:89818461-89818483 GAGGAGAGGAGACCCATAGTGGG + Intergenic
958195376 3:90236145-90236167 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
958418795 3:93907560-93907582 GCTCAGAGGAGACCCTCAGTGGG - Intronic
958561998 3:95759353-95759375 GCTCTCAGGAAACCCAAAGTGGG + Intergenic
958572892 3:95911268-95911290 GCTCAGAGGAGACCCACAGTGGG + Intergenic
958584428 3:96068803-96068825 GCTCTCAGGAGACCCAAACTGGG + Intergenic
958675510 3:97264760-97264782 GCTCTGAGGAGACCCACAGTGGG + Intronic
958678099 3:97292832-97292854 GCAGAGAGGAGACCCGTGGTGGG + Intronic
958678177 3:97293316-97293338 GCGGAGAGGAGACCCAGGGTAGG + Intronic
959037507 3:101384081-101384103 GCTGAGAGGGGACCCACAGTGGG - Intronic
959252575 3:103966458-103966480 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
959327684 3:104957432-104957454 GCAGAGAGGGGACCCAAAGTGGG + Intergenic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
960634194 3:119767816-119767838 GCTCAGAGGAGACCCACAGTGGG + Intergenic
961311435 3:126004382-126004404 GCTCTCAGGAGACCCGGAGTGGG - Intergenic
961525849 3:127496863-127496885 GCTCAGAGGAGACCAGCAGTTGG - Intergenic
961942925 3:130656344-130656366 GCTCAGAGGAGACCTGCAGTGGG + Intronic
962211966 3:133486901-133486923 GCTCAGAGGAGACCCACAGTGGG + Intergenic
962211975 3:133486971-133486993 GCAGAGAGGAGACCCACAGTGGG + Intergenic
962646793 3:137448165-137448187 GCTCAGAGGAACTCCCTAGTGGG - Intergenic
963805205 3:149715042-149715064 GCTCAGAGGAGACCTGCAGTGGG - Intronic
963855193 3:150246193-150246215 GCTCAGAAGAGTCCCATGCTTGG - Intergenic
964075149 3:152684267-152684289 GCAGAGAGGATACCCATAGTGGG + Intergenic
964710943 3:159671007-159671029 GCTCAGAAGAGTCCTATACTTGG - Intronic
964791754 3:160459884-160459906 GCTCAGAGGATCCCCGCAGTGGG + Intronic
964927805 3:161978778-161978800 GCAGAGAGGAGACCCGGAGTGGG + Intergenic
965005684 3:163019513-163019535 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
965118566 3:164521781-164521803 GATCAGAGGAGACCCACAGTGGG + Intergenic
965118579 3:164521849-164521871 GCAGTGAGGAGACCCACAGTGGG + Intergenic
965118587 3:164521918-164521940 GCTGAGAGGAGACCCACAGTGGG + Intergenic
965118596 3:164521987-164522009 GCTGAGAGAAGACCCATGATGGG + Intergenic
965188025 3:165490192-165490214 AATCAGAGGAGACTCATAGTTGG + Intergenic
965367803 3:167820999-167821021 GCAGAGAGGAGACCCACAGTGGG - Intronic
965401511 3:168218285-168218307 GTTCAGAGGAGGGCCAGAGTGGG + Intergenic
965541478 3:169875636-169875658 GCTCAGAGGAGACCCACAGTGGG - Intergenic
965984608 3:174736398-174736420 GCTCAGAGAAGACCCACATTGGG + Intronic
966172622 3:177099407-177099429 TGTCAGAGGAGACTCTTAGTTGG + Intronic
967222083 3:187255917-187255939 GCTCAGAAGAGACCCTGAGCTGG - Intronic
1202741857 3_GL000221v1_random:63226-63248 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
968838289 4:2981399-2981421 GCTCTCAGGAGACCCAAAATGGG + Intronic
970312038 4:14792956-14792978 GCTCATAGGAGAGGCATGGTGGG + Intergenic
970959713 4:21857632-21857654 GCTCAGAGGAGACCCACAGTGGG - Intronic
971079782 4:23196003-23196025 GCTCAGAGGAGACCCACAGTGGG - Intergenic
971475107 4:27065440-27065462 GCTCAGAAGATCCCCATACTTGG - Intergenic
971714041 4:30153055-30153077 GCTCAGAGGAGACCTACAGTGGG + Intergenic
971834600 4:31747726-31747748 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
972072612 4:35039278-35039300 GCTCAGAGGAGACCTGCAGTTGG - Intergenic
972106487 4:35494612-35494634 GCAGAGAGGAGACCCACAGTGGG - Intergenic
972106513 4:35494761-35494783 GCTCAGAGGAGACCCACAGTGGG - Intergenic
972128715 4:35802423-35802445 GCTCAGAGGAAACCCACAGGGGG - Intergenic
972462785 4:39320939-39320961 TCTCAGAGTTGACTCATAGTTGG - Intronic
972645879 4:40967179-40967201 GCTCAGAGGAGACCCACAGTAGG - Intronic
972788234 4:42346792-42346814 GCTCTCAGGAAACCCAGAGTGGG - Intergenic
973026882 4:45284123-45284145 GCAGAGAGGAGACACAGAGTGGG + Intergenic
973362451 4:49177936-49177958 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
973398649 4:49618925-49618947 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
974023484 4:56711813-56711835 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
974235840 4:59180022-59180044 GCTGAGAGGAGACCCACAGTCGG - Intergenic
974278439 4:59758899-59758921 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
974285091 4:59855539-59855561 GCTCAGAGGACACCTGCAGTGGG + Intergenic
974420175 4:61662858-61662880 GCAGAGAGGAGACCCACAGTGGG - Intronic
974420184 4:61662928-61662950 GCAGAGAGGAGACCCACAGTGGG - Intronic
974420192 4:61662998-61663020 GCTCAGAGGAGACTTACAGTGGG - Intronic
974515041 4:62897601-62897623 GCTCTCAGGAGACCCAAACTGGG - Intergenic
974615242 4:64271739-64271761 GCAGAGAAGAGACCCAAAGTGGG - Intergenic
974628940 4:64458145-64458167 GCTCTCAGGAGACCCATAGTGGG - Intergenic
974683448 4:65194638-65194660 GCTCACAGGGGACCTACAGTGGG + Intergenic
974686792 4:65241869-65241891 GCAGAGAGGAGACCCGTAGTGGG + Intergenic
974697976 4:65398840-65398862 GCTTTAAGGAGACCCAAAGTGGG - Intronic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
975023598 4:69521092-69521114 GCTCTCAGGAGACCCTAAGTGGG - Intronic
975044452 4:69783998-69784020 GCTCAGAGAAGACCCACAGTGGG - Intronic
975221151 4:71814233-71814255 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
975254303 4:72215858-72215880 GCTCATAGGAGACCCACAATGGG + Intergenic
975299753 4:72775489-72775511 GTGGAGAGGAGACCCATAGAGGG - Intergenic
975299772 4:72775626-72775648 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
975321373 4:73012419-73012441 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
976027757 4:80711312-80711334 GCTCAGAGGAGCCACAGAGCTGG + Intronic
976097780 4:81527814-81527836 GCTCAGAGGAGACCTGCAGTGGG + Intronic
976129720 4:81871222-81871244 GCAGAGAGGAGACCCATGGTGGG - Intronic
976567847 4:86572646-86572668 GCTCAAAAGAGTCCCATATTCGG - Intronic
976647392 4:87400201-87400223 GCTCAGAGGAGACCCACAGTGGG - Intergenic
976679876 4:87745147-87745169 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
976815803 4:89147977-89147999 GCTCAGAGGAGACCTGCGGTGGG + Intergenic
976921443 4:90449200-90449222 GCTAAGAGGAGACCCACAGTGGG + Intronic
976922634 4:90457577-90457599 GCTGAGAGAAGACCCACAGTGGG + Intronic
977033958 4:91925239-91925261 GCTCAGAGCGGACCCACAGTGGG - Intergenic
977359143 4:95981462-95981484 GCTCAGAGGAAACCCACAGCAGG - Intergenic
977410325 4:96653813-96653835 GCTCTCAGGAGACCCAGGGTGGG - Intergenic
977645879 4:99410786-99410808 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
977705165 4:100062435-100062457 GCTCAGAGGACCCCCACACTTGG + Intergenic
977816200 4:101416605-101416627 GCTCAGAGGAGACCCATGGTAGG + Intronic
978183960 4:105835908-105835930 GCCGAGAGGAGACCCACAGAGGG + Intronic
978229851 4:106385509-106385531 GCTCAGAGAAGACCCACAGTGGG + Intergenic
978248524 4:106604043-106604065 ACTCAAAGGAGACCCGCAGTGGG + Intergenic
978248537 4:106604112-106604134 GCAGAGAGGAGACCCACAGTGGG + Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
978301011 4:107269844-107269866 GCTGAGAGGACACCTACAGTAGG + Intronic
978498510 4:109384871-109384893 GCTCAGAGGAGACTCACAGTGGG - Intergenic
979010827 4:115366127-115366149 GCTCTCAGGAGACCCAAAATAGG - Intergenic
979462910 4:121003775-121003797 GCTCAGAGGAGACCCACAGGGGG - Intergenic
979637866 4:122977999-122978021 GTGGAGAGGAGACCCAGAGTGGG + Intronic
979637909 4:122978270-122978292 GCGGAGAGGAGACCCGGAGTGGG + Intronic
980007643 4:127559724-127559746 GCTTAGAGGAGACTCACAGGGGG - Intergenic
980180291 4:129393083-129393105 GCTCAGAGGAAACTCGCAGTGGG - Intergenic
980253584 4:130349128-130349150 GCTCAGATGATACCCACACTGGG + Intergenic
980282296 4:130737232-130737254 GTGTAGAGGAGACCCAAAGTGGG - Intergenic
980450269 4:132960118-132960140 GCTCAGAGGAGACCCAGAGTGGG - Intergenic
980671184 4:136008909-136008931 GCTCAGAGGAGACCCATATTGGG - Intergenic
980745000 4:137001360-137001382 GCTCAGAGGAGACCCGTAGTGGG - Intergenic
981889162 4:149715731-149715753 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
982181458 4:152751811-152751833 GCAGAGAGGAGACCCTGAGTGGG - Intronic
982392281 4:154877629-154877651 GCTGAGAGGAGCCACAGAGTCGG + Intergenic
982611096 4:157575086-157575108 GCTCAGAGGAGACCTGCATTGGG - Intergenic
982710212 4:158750397-158750419 GCTCAGAGAAGATCCAGAGGAGG - Intergenic
982856179 4:160385389-160385411 GCTCTCAGGTGACCCAGAGTGGG + Intergenic
982856197 4:160385528-160385550 GCAGAAAGGAGACCCACAGTGGG + Intergenic
982957733 4:161792650-161792672 GGGGAGAGGAGACCCACAGTGGG - Intronic
983000532 4:162408918-162408940 GCTCAGAGGAGACCCACAGTGGG + Intergenic
983125802 4:163949631-163949653 GCTCAGAGGAGACCCACAGTGGG + Intronic
983125811 4:163949701-163949723 TCAGAGAGGAGACCCACAGTGGG + Intronic
983125827 4:163949836-163949858 GCAGAGAGGAGACCCATATTGGG + Intronic
983125838 4:163949906-163949928 GCAGAGAGGAGACCCAACGTGGG + Intronic
983323814 4:166227758-166227780 GTGGAGAGGAGACTCATAGTGGG - Intergenic
983323827 4:166227828-166227850 GCTCTCAGAAGACCCAAAGTTGG - Intergenic
983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG + Intronic
983431041 4:167651977-167651999 GCTTGGAGGAGACCCGTAGAGGG - Intergenic
983491965 4:168399035-168399057 GCTCAGAGGAGACCTGCAGTGGG - Intronic
983651512 4:170040851-170040873 GCTCAGAGGAGAGCCACAGTGGG - Intergenic
983715496 4:170776708-170776730 GCTCAGAGGAGACCCACAGTGGG - Intergenic
983885379 4:172975288-172975310 GTGGAGAGGAGACCCAGAGTGGG + Intronic
984058316 4:174957571-174957593 GCAGAGAGCAGACCCAGAGTAGG - Intronic
984102079 4:175499116-175499138 GCTCAGAGGAGATCCACAGGGGG + Intergenic
984296688 4:177862320-177862342 GTGGAGAGGAGACCCATACTGGG - Intronic
984296700 4:177862390-177862412 GCTCAGAGGAGACCCACAGTTGG - Intronic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
984375381 4:178922596-178922618 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
984763802 4:183384336-183384358 GTGGAGAGGAGACCCATGGTGGG - Intergenic
984763826 4:183384476-183384498 ACAGAGAGGAGACCCACAGTGGG - Intergenic
984763837 4:183384546-183384568 ACAGAGAGGAGACCCACAGTGGG - Intergenic
1202759788 4_GL000008v2_random:99409-99431 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
986267874 5:6205916-6205938 GCTCAGAAGAGACCCAGTGGGGG - Intergenic
986503817 5:8429425-8429447 GCTTAGAGGAGACCCACAGTAGG + Intergenic
986923564 5:12717687-12717709 GCTCAGAGGAGACTCACAGTGGG - Intergenic
987815962 5:22901464-22901486 GCTCTTAGGAGACCCAAAGTGGG + Intergenic
987875455 5:23675137-23675159 GCTCTCAGGAGCCCCAAAGTGGG - Intergenic
987951893 5:24686982-24687004 GCTCAGAGGAGAACCACAGTGGG + Intergenic
987951913 5:24687122-24687144 GCAGAGAGGAGACCCACAGTGGG + Intergenic
987951926 5:24687200-24687222 GCAGAGAGGAAACCCATAGTGGG + Intergenic
988093176 5:26568925-26568947 GCTCAGAGAAGACCTACAGGGGG + Intergenic
988202292 5:28083552-28083574 GCAGACAGGAGACCCAAAGTGGG - Intergenic
988565865 5:32319839-32319861 GCTCAGAGGAGATCCACAGTGGG + Intergenic
989101022 5:37823160-37823182 GCTCAGAGAAGACAAATATTTGG + Intronic
989282773 5:39664822-39664844 GTGGAGAGGAGACCCAAAGTGGG - Intergenic
989339203 5:40354912-40354934 GCTCAGAGGAGACCTGCAGTAGG - Intergenic
989425398 5:41290602-41290624 GCTCTCAGGAGACCCAGAGTGGG + Intergenic
989520716 5:42396943-42396965 GCTCAGAGGAGACCAACATTGGG - Intergenic
989730422 5:44641582-44641604 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
990023789 5:51160342-51160364 GCTTAGAGGAGACCAGCAGTGGG - Intergenic
991039626 5:62162266-62162288 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
991230913 5:64331578-64331600 GTTCTCAGGAGACCCACAGTGGG - Intronic
991359231 5:65802706-65802728 GCTTAGAGGAGACGCACAATGGG + Intronic
992693071 5:79259017-79259039 ACTCAGAGGAGACCTGTAGTGGG + Intronic
994246899 5:97488773-97488795 GCTCTCAGGAGACTCATAGTGGG + Intergenic
994452062 5:99955660-99955682 GCTTTCAGGAGACCCAAAGTGGG + Intergenic
994593924 5:101807117-101807139 GCAGAGAGGAGACCCACAGTGGG - Intergenic
994692322 5:103034309-103034331 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
994692344 5:103034448-103034470 GCTGAGAGGAGACCCACAGTGGG + Intergenic
994692354 5:103034516-103034538 GCTGAGAGGAGACCCACAGTGGG + Intergenic
994891341 5:105639954-105639976 GCAGAGAGGATACCCACAGTAGG - Intergenic
994891350 5:105640021-105640043 GCAGAGAGGAGACCTACAGTGGG - Intergenic
994916251 5:105983058-105983080 GCAGAGAGGAGACCCAGAGTGGG - Intergenic
994948111 5:106422959-106422981 GCAGAGAGGAGACACAAAGTGGG - Intergenic
995032834 5:107498674-107498696 GCTCAGAAGGGCCCCATACTTGG - Intronic
995146046 5:108787698-108787720 CAGCGGAGGAGACCCATAGTGGG - Intronic
995146071 5:108787834-108787856 GCTCTCAGGAGACTCAAAGTGGG - Intronic
995332107 5:110957100-110957122 GCAGAGAGGAGACCCACACTGGG - Intergenic
995386658 5:111596349-111596371 GTGGAGAGGAGACCCAGAGTGGG - Intergenic
995744917 5:115393360-115393382 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
996923790 5:128799727-128799749 GCTCAGAGGAGACCCACAGTAGG + Intronic
997042768 5:130277677-130277699 GCAGAGAGGAAACCCAGAGTGGG + Intergenic
997960493 5:138316850-138316872 GCTCAGAGGAGACCCACAGGGGG - Intronic
998044651 5:138976641-138976663 CCTCAGAGGAAGCACATAGTAGG + Intronic
998161766 5:139817016-139817038 GCTGAGTGGAGACCCACAGGGGG - Intronic
998480515 5:142459114-142459136 GCTGAGAGGAGACCCACAGTGGG + Intergenic
999214155 5:149917748-149917770 GCCTAGAGAACACCCATAGTAGG - Intronic
999315337 5:150579856-150579878 GTGGAGAGGAGACCCACAGTGGG - Intergenic
1000266317 5:159641374-159641396 GCTCAGAGGAGATCTGCAGTGGG - Intergenic
1000352412 5:160362311-160362333 GCTCCGAGAACACCCATATTTGG + Intronic
1000426265 5:161094144-161094166 GCTCAGAGGAGACATGCAGTAGG - Intergenic
1001934794 5:175696342-175696364 GCTCAGAGGGGGCCCAGAGTTGG - Intergenic
1002986279 6:2192290-2192312 GCTCAGAGAAGACCCACAGTGGG - Intronic
1003439021 6:6122370-6122392 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1003439029 6:6122428-6122450 GTGAAGAGGAGACCCACAGTGGG - Intergenic
1004304560 6:14488115-14488137 GCTCAGAGGAAACCCGCACTGGG - Intergenic
1004720784 6:18265895-18265917 GTGGAGAGGAGACCCATAGTGGG + Intergenic
1005021413 6:21422997-21423019 GCTCAGAGGAGACCGACAGTGGG + Intergenic
1005258862 6:24035125-24035147 GCTCAGAGGAGCCGCAAAGCCGG - Intergenic
1005594768 6:27368525-27368547 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1005775898 6:29130377-29130399 GCTCAGAGGAGACACATAGAGGG - Intergenic
1006348022 6:33498639-33498661 GGTCAGAGGAGACCCACAGTGGG - Intergenic
1006447727 6:34089196-34089218 GCTCAGAGGAGCACCAGAGAGGG - Intronic
1006463766 6:34178902-34178924 GCTCTCAGGAGACCCGGAGTGGG + Intergenic
1006500989 6:34458614-34458636 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1006621856 6:35370862-35370884 GCTCACACGAGCCCCATGGTGGG + Intronic
1006753817 6:36397054-36397076 GCTCAGAGGAGATCCGCAGTGGG - Intronic
1006766205 6:36509235-36509257 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1007251985 6:40501980-40502002 GCCCAGTGGAGACCCAGAGAGGG + Intronic
1007837342 6:44683878-44683900 TCTCAAAGGTGGCCCATAGTGGG + Intergenic
1008330612 6:50240482-50240504 GCTCAGAGGAGACTCATAGTGGG + Intergenic
1008330617 6:50240552-50240574 GCAGAGAGGAAACCCACAGTGGG + Intergenic
1009243336 6:61204789-61204811 GCAGAGAGGAGACCTACAGTGGG + Intergenic
1009558835 6:65211876-65211898 ACTCAGAGGAAACCCAAAGTAGG + Intronic
1009582742 6:65557808-65557830 GCTCTCAGGAGACCCAAAATGGG + Intronic
1009643058 6:66362555-66362577 GCTCTCAAGAGACCCATAGCAGG + Intergenic
1009846855 6:69145680-69145702 GCTCAGAGGAGACCTTCAGTGGG + Intronic
1010341171 6:74754940-74754962 GCTCAGAGGAGACCAGCAGAGGG - Intergenic
1010489095 6:76452789-76452811 GCAAAGAGGAGACCCGAAGTGGG + Intergenic
1010519734 6:76818175-76818197 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1010846909 6:80720433-80720455 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1010884092 6:81215511-81215533 GCTCAGAGGAAGCCCACACTGGG - Intergenic
1011284152 6:85706044-85706066 GCAGAGAGGAGACCCACACTGGG + Intergenic
1011795608 6:90948249-90948271 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1011822586 6:91271198-91271220 GCTCTCAGGAGACCTGTAGTGGG + Intergenic
1011822596 6:91271268-91271290 GCAGAGAGGAGACCCATGGTGGG + Intergenic
1012052214 6:94360958-94360980 GCCCAGAGAAGACCCGCAGTGGG + Intergenic
1012100858 6:95084217-95084239 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1012122415 6:95384696-95384718 GCTCAGAGGAGACCCACATTGGG - Intergenic
1012169519 6:96001788-96001810 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1012752814 6:103184509-103184531 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1013235997 6:108198426-108198448 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1013375598 6:109510642-109510664 GCTCAGAGGAGACCCACAGTGGG - Intronic
1013542155 6:111121775-111121797 GCTCAGAAGGGTCCCATACTTGG + Intronic
1013693170 6:112668572-112668594 GCACAGAGGAGGCCCACAGTGGG - Intergenic
1013709381 6:112879798-112879820 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1014227118 6:118861540-118861562 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1014227127 6:118861610-118861632 GCAGAGAGGAGACCTATAGTGGG + Intronic
1014391716 6:120872708-120872730 GCTGAGAGGAGATCCACAGTGGG - Intergenic
1014391727 6:120872778-120872800 GCTAAGAAGAGACCCACAGTGGG - Intergenic
1014391746 6:120872918-120872940 GCTCTCAAGAGACCCAGAGTGGG - Intergenic
1014662770 6:124193761-124193783 GCACAAAGGAGACCCACAGCGGG + Intronic
1014770524 6:125453683-125453705 GCCCAGAAGAGACACAAAGTGGG - Intergenic
1014968952 6:127791302-127791324 GCAGAAAGGAGACCCACAGTGGG + Intronic
1015455599 6:133423968-133423990 GCTCAGAGGAGACCCACAGTGGG + Intronic
1015663787 6:135604221-135604243 GCTCAGAGGAAACCCTCAGAGGG - Intergenic
1016163258 6:140907848-140907870 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1016339633 6:143049273-143049295 GCTCGGAGGAAACCCACAGTGGG + Intergenic
1017266541 6:152452705-152452727 GCACAGTGGAGACCCATGGAAGG - Intronic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1017522309 6:155213274-155213296 GCTCAGAGGAAACCCACAGTGGG + Intronic
1017587977 6:155947588-155947610 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1019296030 7:275899-275921 GCTCAGCGGAGACCCTCTGTGGG + Intergenic
1019897868 7:3997312-3997334 GCCCAGAGGAGCCCCGCAGTGGG + Intronic
1020586829 7:10079345-10079367 GCTCAGAGGAGACCTGCAGATGG - Intergenic
1020649311 7:10855329-10855351 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1020761297 7:12270304-12270326 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1020832522 7:13109926-13109948 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1021269996 7:18574230-18574252 GTGGAGAGGAGACCCACAGTGGG + Intronic
1021343079 7:19488706-19488728 GCTCTCAGGAGACCCAAAATGGG + Intergenic
1021343087 7:19488776-19488798 GCAGAGAGGAGACCCAGAGCAGG + Intergenic
1021431115 7:20560067-20560089 GCTGAGAGGAGACCCACAACGGG + Intergenic
1021677705 7:23097669-23097691 GTGGAGAGGAGACCCATAGTGGG - Intergenic
1021939503 7:25665711-25665733 GCTCAGAGGAGAGCCTAAGCTGG + Intergenic
1022391923 7:29950764-29950786 GCAGAGAGGAGACCTGTAGTGGG - Intronic
1022391933 7:29950834-29950856 GCTCTCAGGGGACCCAAAGTGGG - Intronic
1023699983 7:42883223-42883245 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1024024672 7:45400310-45400332 GCTCTCAGGACACCCAAAGTAGG - Intergenic
1024794838 7:53008239-53008261 GCAGAGAGGAGACCCAGAGTGGG - Intergenic
1024794850 7:53008309-53008331 GCAGAGAGGAGACCCAAGGTAGG - Intergenic
1024857000 7:53794224-53794246 GTTCTCAGGAGACCCAAAGTGGG + Intergenic
1026370137 7:69690988-69691010 GCAGAGAGGAGACCCATAGTGGG + Intronic
1027333667 7:77126463-77126485 GCTCAGAGGAGACCCACAGTGGG + Intronic
1027575224 7:79922570-79922592 GCAGAGAGGAGACCCAGAGTGGG - Intergenic
1027575232 7:79922640-79922662 GCTCAGAAGAAACCCACAGTGGG - Intergenic
1027687338 7:81294509-81294531 GCTCTCAGGAAACCCAAAGTGGG + Intergenic
1027734890 7:81920255-81920277 GCAGGGAGGAGACCCATAGTAGG + Intergenic
1027924878 7:84447628-84447650 GCTCTTAGGAGACCCGAAGTGGG - Intronic
1028024642 7:85821696-85821718 GCTCAAATGAAACCCATAGCGGG - Intergenic
1028052217 7:86202465-86202487 GCAGAGTGGAGACCCACAGTGGG + Intergenic
1028052248 7:86202682-86202704 GCAGCGAGGAGACCCACAGTGGG + Intergenic
1028053066 7:86208589-86208611 GCAGAGAGGAGACCCACAGCAGG + Intergenic
1028136809 7:87230926-87230948 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1028401910 7:90433681-90433703 GCTTTTAGGAGACCCAAAGTTGG + Intronic
1028527358 7:91801037-91801059 GCTCAGAGGAGACCCACAGAGGG + Intronic
1029327686 7:99823835-99823857 GCTCACAGGAGACCCACAAAGGG - Intergenic
1029782126 7:102744869-102744891 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1029899367 7:104022826-104022848 GTTCAGAGGAAACCCACAGGGGG - Intergenic
1030243824 7:107359723-107359745 GTACAGAGGAGACCCAGAGTGGG - Intronic
1030243857 7:107359933-107359955 GTGGAGAGGAGACCCAGAGTGGG - Intronic
1030484456 7:110148777-110148799 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1030484483 7:110148979-110149001 GCAAAGAGGAGACCCAGGGTGGG + Intergenic
1030721973 7:112881667-112881689 GCGGAGAGGAGACCCAGAGTTGG - Intronic
1031196981 7:118627668-118627690 GCTGAGTGCAGACCCACAGTGGG + Intergenic
1031242024 7:119257964-119257986 GCTCAGAGGAGACCTGCAGGTGG + Intergenic
1031265339 7:119573169-119573191 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1031743672 7:125467851-125467873 GCTCAGAGGAGACCAGCACTGGG + Intergenic
1031836996 7:126690752-126690774 ACTCAGAGGAGACCTGCAGTGGG + Intronic
1032649131 7:133858271-133858293 GCAGAGAGGAGACCCAAAGTGGG + Intronic
1032658283 7:133955254-133955276 GCTCAGTGGAGACCTGCAGTGGG + Intronic
1032858566 7:135857735-135857757 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1032919230 7:136527214-136527236 GCTCACAGGAGACCCAGAGTGGG + Intergenic
1034101759 7:148456980-148457002 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1034210359 7:149357873-149357895 GCTCAGAGGAAACCCACAGTCGG + Intergenic
1034215883 7:149405258-149405280 GCAGAGAGGAGACCCAAAGTGGG + Intergenic
1035760167 8:2063006-2063028 CATCAGAGGAGACCTATATTAGG - Intronic
1036497325 8:9281104-9281126 GCTCAGGGGAGACCAGTAGGGGG + Intergenic
1036907684 8:12720770-12720792 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1037553928 8:20004143-20004165 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1038149379 8:24928574-24928596 GCTCGGAGGAGACACACAGGGGG - Intergenic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1039210107 8:35204283-35204305 GCTCTCAGGAGACTCAAAGTGGG + Intergenic
1040661900 8:49583626-49583648 GCTCAGAGAAGACCTTCAGTGGG - Intergenic
1040725592 8:50378580-50378602 GCTCAGAGGAAAGCCACAGCAGG + Intronic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1041274451 8:56142745-56142767 GCAGAGAGGAGACCCAGAGTGGG - Intergenic
1041311920 8:56525888-56525910 GCTCAGAGGAGCCTCTTGGTTGG - Intergenic
1041636908 8:60155292-60155314 GCTATGAGTAGACCCATTGTGGG + Intergenic
1041965433 8:63669973-63669995 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1042439644 8:68810765-68810787 CCTGAGAGGAGACCCACAGTGGG + Intronic
1042625133 8:70748963-70748985 GCACAGAGGAGACCTATGGTGGG - Intronic
1042625146 8:70749033-70749055 GCAGAGAGGAGACCCATGGTGGG - Intronic
1042687806 8:71461746-71461768 GCTCAGAGGAGATCCTGAGGGGG + Intronic
1043180538 8:77082605-77082627 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1043180547 8:77082675-77082697 GCAGAGAGGAGACCCGTGGTAGG + Intergenic
1043218096 8:77621198-77621220 GATGAGAGGGGACCCAAAGTAGG + Intergenic
1043695246 8:83208877-83208899 GCTCTCAGGAGATCCAAAGTGGG - Intergenic
1043702805 8:83312578-83312600 GTTCTCAGGAGACCCACAGTGGG + Intergenic
1043734177 8:83723804-83723826 AGTCAGAGGTGACCCAAAGTGGG + Intergenic
1043737662 8:83768269-83768291 GCTTTCAGGAGACCCACAGTGGG + Intergenic
1043737721 8:83768619-83768641 GCAGAGAAGAGACCCAGAGTGGG + Intergenic
1043798606 8:84578629-84578651 GCAGAAAGGAGACCCAAAGTGGG + Intronic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1044409614 8:91868640-91868662 GCTCAGAGGAGACCCACAGGAGG - Intergenic
1044412627 8:91901646-91901668 GCTCAGAGGAGACCCAGAGTGGG + Intergenic
1044774903 8:95677909-95677931 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1044962389 8:97543236-97543258 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1045243611 8:100423772-100423794 ACTAAGAGGTGACACATAGTAGG - Intergenic
1045873415 8:106950660-106950682 GCTCTCAAGAGACCCAAAGTGGG - Intergenic
1045888050 8:107123091-107123113 GCAGAGAGGAGACCCAGAGTTGG - Intergenic
1046140465 8:110083780-110083802 ACTCAGAGGAGACCCCCAGTGGG - Intergenic
1046186994 8:110734533-110734555 GCTCTAAGGAGACCCACAGTGGG + Intergenic
1046195755 8:110860842-110860864 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1046395215 8:113632379-113632401 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1046407289 8:113790889-113790911 GCTCTGAGGAGACCCACAGTTGG + Intergenic
1046503703 8:115111223-115111245 GCTCAGAAGAGACCTGCAGTGGG + Intergenic
1046674616 8:117094360-117094382 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1047318318 8:123754783-123754805 GCTCTCAGGAGACCCAATGTTGG + Intergenic
1048922326 8:139242410-139242432 TCTCAGAGCAGCCACATAGTGGG + Intergenic
1049140530 8:140950066-140950088 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1049721271 8:144116540-144116562 GGGCAGAGGAGACCCATAGCGGG + Exonic
1049824069 8:144655640-144655662 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1049826802 8:144674299-144674321 GCTCTTGGGAGACCCACAGTGGG + Intergenic
1050182379 9:2934690-2934712 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1050426207 9:5515509-5515531 GCTTTCAGGAGACCCAAAGTGGG + Intronic
1050725547 9:8644325-8644347 GCTCAGAGGAGACCCATAGTGGG - Intronic
1050937264 9:11413963-11413985 GCTCAGAGGAGATCCACAGTGGG - Intergenic
1051001790 9:12290943-12290965 GCTTAGGGGAGACCCACAGTGGG - Intergenic
1051418774 9:16870678-16870700 GCTAAGAGGAGACCAAGAGGCGG - Exonic
1051749471 9:20326210-20326232 GCTCAGAGCATACCCACAGAAGG - Intergenic
1052437172 9:28444060-28444082 GCTCTCAGGACACCCAAAGTTGG - Intronic
1052466779 9:28839558-28839580 GCTGAGAGGAGACCCACAATGGG + Intergenic
1052552518 9:29969586-29969608 ACTGAGAGGAGACCCAAAATGGG + Intergenic
1052580587 9:30349589-30349611 GCTCTGAGGAGACCTGAAGTGGG + Intergenic
1052652344 9:31321113-31321135 GCTCAGAGGAGACCCACACTGGG + Intergenic
1052691473 9:31821173-31821195 GAGGAGAGGAGACCCAGAGTGGG - Intergenic
1053445092 9:38146515-38146537 GCAGAGAGAAGACCCACAGTGGG - Intergenic
1053445101 9:38146582-38146604 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1053617437 9:39782095-39782117 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053619129 9:39798413-39798435 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053875619 9:42541458-42541480 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053877284 9:42557762-42557784 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053895381 9:42736926-42736948 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1053897029 9:42753175-42753197 GCTCAGAGAAGACGCACAGTGGG + Intergenic
1054234409 9:62543960-62543982 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054236080 9:62560266-62560288 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054265028 9:62909016-62909038 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054266729 9:62925342-62925364 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054550222 9:66594796-66594818 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1055230477 9:74058127-74058149 ACTCAGAGTAGACCCAGAGTGGG - Intergenic
1055645495 9:78357981-78358003 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1055816571 9:80213366-80213388 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1055890865 9:81122409-81122431 GCTCAGAGGTGACCTGCAGTGGG + Intergenic
1055890876 9:81122479-81122501 GCAGAGAGAAGACCCACAGTGGG + Intergenic
1056191983 9:84194086-84194108 GCTCAGAGGAGACCCACAATGGG + Intergenic
1056462198 9:86818762-86818784 GCTCAGAGGAGACCTGGAGATGG - Intergenic
1056986174 9:91365017-91365039 GCTCGGAGGAGACCCGCAGTGGG - Intergenic
1056994409 9:91443107-91443129 GTAGAGAGGAGACCCACAGTGGG + Intergenic
1058077718 9:100667637-100667659 GCAGAGAGAAGACCCACAGTGGG - Intergenic
1058270611 9:102967723-102967745 GTGGAGAGGAGACCCAGAGTGGG + Intergenic
1058510850 9:105714264-105714286 GCTCAGAGAAGACCCACAGTGGG - Intronic
1058545735 9:106059157-106059179 GTGGAGAGGAGACCCAGAGTGGG + Intergenic
1058545744 9:106059227-106059249 GTACAGAGGAGACCCAGACTGGG + Intergenic
1059232341 9:112732801-112732823 GCTTGGAGGAGACCCAGAGTGGG + Intergenic
1060618842 9:125044524-125044546 GCTCTCAGGAGACCCCTAGTAGG - Intronic
1060993959 9:127865317-127865339 GCTCAGAGGAGACCTAGTGGTGG - Intergenic
1061004083 9:127918497-127918519 GCTCAAAGGAGGCCCCTAGGGGG - Intergenic
1061680136 9:132238890-132238912 GCCCAGAGGAGAACCTGAGTAGG - Intronic
1061743196 9:132722287-132722309 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1062184778 9:135212140-135212162 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1062329156 9:136029276-136029298 GCTGAGAGGAGACCCACAGTGGG - Intronic
1203691579 Un_GL000214v1:47624-47646 GCTCAGAGGAGACCTGCAGTCGG + Intergenic
1203751803 Un_GL000218v1:87108-87130 GCTGAGAGGAGACGCACGGTGGG - Intergenic
1203751813 Un_GL000218v1:87181-87203 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1203757372 Un_GL000218v1:146095-146117 CCTCAAAGGTGACCCAAAGTGGG + Intergenic
1203710487 Un_KI270742v1:93150-93172 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1203540564 Un_KI270743v1:84304-84326 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1203612277 Un_KI270749v1:20863-20885 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1203644716 Un_KI270751v1:56567-56589 GCTCAGAGGAGACCTGCAGTCGG - Intergenic
1186509441 X:10119400-10119422 GGTCAGAGGAGAGACAGAGTGGG + Intronic
1187378463 X:18778730-18778752 TTTCAGAGGAAACTCATAGTAGG + Intronic
1188194974 X:27222373-27222395 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1188647907 X:32592451-32592473 GTAGAGAGGAGACCCATGGTGGG - Intronic
1188756569 X:33969796-33969818 GCTCAGAGGAGACGCTCAGTGGG - Intergenic
1189023929 X:37371314-37371336 GCTCAGAGGAGACCCACATTGGG - Intronic
1189237124 X:39495676-39495698 GCTCAGAGAAGAAACAGAGTGGG + Intergenic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1190621152 X:52288128-52288150 GAAGAGAGGAGACCCATAGTGGG - Intergenic
1190621188 X:52288342-52288364 GTGGAGGGGAGACCCATAGTGGG - Intergenic
1190621225 X:52288552-52288574 GTGGAGAGGAGACCCATAGTGGG - Intergenic
1190621235 X:52288622-52288644 GCTTTCAGGAGACCCAAAGTAGG - Intergenic
1190681793 X:52832003-52832025 GCTCAGAGGAGATCCGCAGTGGG - Intergenic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1191102449 X:56746527-56746549 GGTCTGATGAGACCCATAGCAGG - Intergenic
1192265286 X:69533488-69533510 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1192630545 X:72774547-72774569 GCTCAGAGGCAACTGATAGTGGG + Intergenic
1192651165 X:72946257-72946279 GCTCAGAGGCAACTGATAGTGGG - Intergenic
1193108375 X:77703801-77703823 GCTCAGAGGAAACCCAAAGGGGG + Intronic
1193467598 X:81867819-81867841 ACTCAGAGAAGACCCAAAGTGGG + Intergenic
1193468690 X:81875016-81875038 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
1193554213 X:82933028-82933050 GCTCAAAAGAGACCCGCAGTGGG - Intergenic
1194212248 X:91082909-91082931 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
1194379411 X:93175564-93175586 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1194380354 X:93182272-93182294 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
1194517304 X:94871130-94871152 GCATAGAGGAGACCCAAAGTGGG - Intergenic
1194891456 X:99384481-99384503 GCTCTCAGGAGACCCACAGTGGG + Intergenic
1195178485 X:102333793-102333815 GCTCAGAGGATACCCGAAGGGGG + Intergenic
1195180379 X:102353290-102353312 GCTCAGAGGATACCCGAAGGGGG - Intergenic
1197035703 X:121870763-121870785 GCTGAGAGGAGACCCACAGTGGG - Intergenic
1197035718 X:121870833-121870855 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1197106463 X:122722293-122722315 GCTCAGAAGAGTCCCATTGTTGG - Intergenic
1197342247 X:125287909-125287931 GCAGAGAGGAGAACCACAGTCGG - Intergenic
1197378458 X:125710216-125710238 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197421324 X:126238828-126238850 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197609496 X:128622922-128622944 GCTCAGAGGAGGCCCACATTGGG + Intergenic
1197795937 X:130299064-130299086 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1198189514 X:134288264-134288286 GCAGAGAGGGGACCCAGAGTGGG - Intergenic
1198317840 X:135487319-135487341 GCTCAGAAGAGCCGCATAGTTGG + Intergenic
1199187946 X:144939064-144939086 GCTCAGAGGAGACCTACAGTGGG + Intergenic
1199861072 X:151800989-151801011 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1199862608 X:151815382-151815404 GCTCAGAAGAGTCCCATGCTGGG + Intergenic
1200749123 Y:6928932-6928954 GCTCTCAGGAGACCTAAAGTGGG + Intronic
1201165458 Y:11204728-11204750 GCTGAGAGGAGACGCACTGTGGG - Intergenic
1201165467 Y:11204801-11204823 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202018145 Y:20434213-20434235 GCTCAGAGAAGACCTGCAGTTGG + Intergenic